ID: 943642845

View in Genome Browser
Species Human (GRCh38)
Location 2:190378226-190378248
Sequence CAGTGCCTGGTGGGGGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943642845_943642857 24 Left 943642845 2:190378226-190378248 CCCCATCCCCCCACCAGGCACTG No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943642845 Original CRISPR CAGTGCCTGGTGGGGGGATG GGG (reversed) Intergenic