ID: 943642845 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:190378226-190378248 |
| Sequence | CAGTGCCTGGTGGGGGGATG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 943642845_943642857 | 24 | Left | 943642845 | 2:190378226-190378248 | CCCCATCCCCCCACCAGGCACTG | No data | ||
| Right | 943642857 | 2:190378273-190378295 | TCTATGAATTTGACTATTCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 943642845 | Original CRISPR | CAGTGCCTGGTGGGGGGATG GGG (reversed) | Intergenic | ||