ID: 943642848

View in Genome Browser
Species Human (GRCh38)
Location 2:190378228-190378250
Sequence GCCAGTGCCTGGTGGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943642848_943642857 22 Left 943642848 2:190378228-190378250 CCATCCCCCCACCAGGCACTGGC No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943642848 Original CRISPR GCCAGTGCCTGGTGGGGGGA TGG (reversed) Intergenic