ID: 943642850

View in Genome Browser
Species Human (GRCh38)
Location 2:190378233-190378255
Sequence CGGTTGCCAGTGCCTGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943642850_943642857 17 Left 943642850 2:190378233-190378255 CCCCCACCAGGCACTGGCAACCG No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943642850 Original CRISPR CGGTTGCCAGTGCCTGGTGG GGG (reversed) Intergenic