ID: 943642851

View in Genome Browser
Species Human (GRCh38)
Location 2:190378234-190378256
Sequence GCGGTTGCCAGTGCCTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943642851_943642857 16 Left 943642851 2:190378234-190378256 CCCCACCAGGCACTGGCAACCGC No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG 0: 56
1: 456
2: 1060
3: 1456
4: 1607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943642851 Original CRISPR GCGGTTGCCAGTGCCTGGTG GGG (reversed) Intergenic
No off target data available for this crispr