ID: 943642852

View in Genome Browser
Species Human (GRCh38)
Location 2:190378235-190378257
Sequence GGCGGTTGCCAGTGCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943642852_943642857 15 Left 943642852 2:190378235-190378257 CCCACCAGGCACTGGCAACCGCC No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943642852 Original CRISPR GGCGGTTGCCAGTGCCTGGT GGG (reversed) Intergenic