ID: 943642853 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:190378236-190378258 |
Sequence | TGGCGGTTGCCAGTGCCTGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
943642853_943642857 | 14 | Left | 943642853 | 2:190378236-190378258 | CCACCAGGCACTGGCAACCGCCA | No data | ||
Right | 943642857 | 2:190378273-190378295 | TCTATGAATTTGACTATTCTAGG | No data | ||||
943642853_943642858 | 30 | Left | 943642853 | 2:190378236-190378258 | CCACCAGGCACTGGCAACCGCCA | No data | ||
Right | 943642858 | 2:190378289-190378311 | TTCTAGGTACCTCAGATAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
943642853 | Original CRISPR | TGGCGGTTGCCAGTGCCTGG TGG (reversed) | Intergenic | ||