ID: 943642853

View in Genome Browser
Species Human (GRCh38)
Location 2:190378236-190378258
Sequence TGGCGGTTGCCAGTGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943642853_943642857 14 Left 943642853 2:190378236-190378258 CCACCAGGCACTGGCAACCGCCA No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG No data
943642853_943642858 30 Left 943642853 2:190378236-190378258 CCACCAGGCACTGGCAACCGCCA No data
Right 943642858 2:190378289-190378311 TTCTAGGTACCTCAGATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943642853 Original CRISPR TGGCGGTTGCCAGTGCCTGG TGG (reversed) Intergenic