ID: 943642854

View in Genome Browser
Species Human (GRCh38)
Location 2:190378239-190378261
Sequence GAATGGCGGTTGCCAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943642854_943642858 27 Left 943642854 2:190378239-190378261 CCAGGCACTGGCAACCGCCATTC No data
Right 943642858 2:190378289-190378311 TTCTAGGTACCTCAGATAAATGG No data
943642854_943642857 11 Left 943642854 2:190378239-190378261 CCAGGCACTGGCAACCGCCATTC No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943642854 Original CRISPR GAATGGCGGTTGCCAGTGCC TGG (reversed) Intergenic