ID: 943642855

View in Genome Browser
Species Human (GRCh38)
Location 2:190378253-190378275
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943642855_943642857 -3 Left 943642855 2:190378253-190378275 CCGCCATTCTACTTTCTGTCTCT No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG No data
943642855_943642858 13 Left 943642855 2:190378253-190378275 CCGCCATTCTACTTTCTGTCTCT No data
Right 943642858 2:190378289-190378311 TTCTAGGTACCTCAGATAAATGG No data
943642855_943642860 30 Left 943642855 2:190378253-190378275 CCGCCATTCTACTTTCTGTCTCT No data
Right 943642860 2:190378306-190378328 AAATGGAATCATACATTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943642855 Original CRISPR AGAGACAGAAAGTAGAATGG CGG (reversed) Intergenic