ID: 943642856

View in Genome Browser
Species Human (GRCh38)
Location 2:190378256-190378278
Sequence CATAGAGACAGAAAGTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943642856_943642860 27 Left 943642856 2:190378256-190378278 CCATTCTACTTTCTGTCTCTATG No data
Right 943642860 2:190378306-190378328 AAATGGAATCATACATTTGTAGG No data
943642856_943642861 28 Left 943642856 2:190378256-190378278 CCATTCTACTTTCTGTCTCTATG No data
Right 943642861 2:190378307-190378329 AATGGAATCATACATTTGTAGGG No data
943642856_943642858 10 Left 943642856 2:190378256-190378278 CCATTCTACTTTCTGTCTCTATG No data
Right 943642858 2:190378289-190378311 TTCTAGGTACCTCAGATAAATGG No data
943642856_943642857 -6 Left 943642856 2:190378256-190378278 CCATTCTACTTTCTGTCTCTATG No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943642856 Original CRISPR CATAGAGACAGAAAGTAGAA TGG (reversed) Intergenic