ID: 943642857

View in Genome Browser
Species Human (GRCh38)
Location 2:190378273-190378295
Sequence TCTATGAATTTGACTATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4635
Summary {0: 56, 1: 456, 2: 1060, 3: 1456, 4: 1607}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943642851_943642857 16 Left 943642851 2:190378234-190378256 CCCCACCAGGCACTGGCAACCGC No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG 0: 56
1: 456
2: 1060
3: 1456
4: 1607
943642849_943642857 18 Left 943642849 2:190378232-190378254 CCCCCCACCAGGCACTGGCAACC No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG 0: 56
1: 456
2: 1060
3: 1456
4: 1607
943642853_943642857 14 Left 943642853 2:190378236-190378258 CCACCAGGCACTGGCAACCGCCA No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG 0: 56
1: 456
2: 1060
3: 1456
4: 1607
943642852_943642857 15 Left 943642852 2:190378235-190378257 CCCACCAGGCACTGGCAACCGCC No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG 0: 56
1: 456
2: 1060
3: 1456
4: 1607
943642854_943642857 11 Left 943642854 2:190378239-190378261 CCAGGCACTGGCAACCGCCATTC No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG 0: 56
1: 456
2: 1060
3: 1456
4: 1607
943642855_943642857 -3 Left 943642855 2:190378253-190378275 CCGCCATTCTACTTTCTGTCTCT 0: 311
1: 993
2: 2041
3: 3715
4: 6098
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG 0: 56
1: 456
2: 1060
3: 1456
4: 1607
943642848_943642857 22 Left 943642848 2:190378228-190378250 CCATCCCCCCACCAGGCACTGGC No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG 0: 56
1: 456
2: 1060
3: 1456
4: 1607
943642856_943642857 -6 Left 943642856 2:190378256-190378278 CCATTCTACTTTCTGTCTCTATG 0: 289
1: 910
2: 1519
3: 2217
4: 3457
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG 0: 56
1: 456
2: 1060
3: 1456
4: 1607
943642846_943642857 23 Left 943642846 2:190378227-190378249 CCCATCCCCCCACCAGGCACTGG No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG 0: 56
1: 456
2: 1060
3: 1456
4: 1607
943642844_943642857 25 Left 943642844 2:190378225-190378247 CCCCCATCCCCCCACCAGGCACT No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG 0: 56
1: 456
2: 1060
3: 1456
4: 1607
943642845_943642857 24 Left 943642845 2:190378226-190378248 CCCCATCCCCCCACCAGGCACTG No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG 0: 56
1: 456
2: 1060
3: 1456
4: 1607
943642850_943642857 17 Left 943642850 2:190378233-190378255 CCCCCACCAGGCACTGGCAACCG No data
Right 943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG 0: 56
1: 456
2: 1060
3: 1456
4: 1607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943642857 Original CRISPR TCTATGAATTTGACTATTCT AGG Intergenic
Too many off-targets to display for this crispr