ID: 943644314

View in Genome Browser
Species Human (GRCh38)
Location 2:190392293-190392315
Sequence CAAAATGTCAATAGTGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943644314_943644322 4 Left 943644314 2:190392293-190392315 CCTTTATCACTATTGACATTTTG No data
Right 943644322 2:190392320-190392342 AAACAATTCTTTGTGGGGAGGGG No data
943644314_943644321 3 Left 943644314 2:190392293-190392315 CCTTTATCACTATTGACATTTTG No data
Right 943644321 2:190392319-190392341 CAAACAATTCTTTGTGGGGAGGG No data
943644314_943644318 -1 Left 943644314 2:190392293-190392315 CCTTTATCACTATTGACATTTTG No data
Right 943644318 2:190392315-190392337 GGACCAAACAATTCTTTGTGGGG No data
943644314_943644320 2 Left 943644314 2:190392293-190392315 CCTTTATCACTATTGACATTTTG No data
Right 943644320 2:190392318-190392340 CCAAACAATTCTTTGTGGGGAGG No data
943644314_943644317 -2 Left 943644314 2:190392293-190392315 CCTTTATCACTATTGACATTTTG No data
Right 943644317 2:190392314-190392336 TGGACCAAACAATTCTTTGTGGG No data
943644314_943644316 -3 Left 943644314 2:190392293-190392315 CCTTTATCACTATTGACATTTTG No data
Right 943644316 2:190392313-190392335 TTGGACCAAACAATTCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943644314 Original CRISPR CAAAATGTCAATAGTGATAA AGG (reversed) Intergenic
No off target data available for this crispr