ID: 943645708

View in Genome Browser
Species Human (GRCh38)
Location 2:190406850-190406872
Sequence CTAAAACTCAAGTGGAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943645704_943645708 0 Left 943645704 2:190406827-190406849 CCTAGAACAAAACCCAAGGAAAA 0: 1
1: 0
2: 11
3: 112
4: 1485
Right 943645708 2:190406850-190406872 CTAAAACTCAAGTGGAGCAAAGG 0: 1
1: 0
2: 0
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943645708 Original CRISPR CTAAAACTCAAGTGGAGCAA AGG Intergenic
900639195 1:3680791-3680813 CTAAAACCCCAGTGGAGCTGAGG - Intronic
900879772 1:5372463-5372485 CTAAAACTCAAGATGAGAATTGG - Intergenic
901381435 1:8877478-8877500 CTGAAAGGCAAGTGAAGCAATGG + Intronic
905842069 1:41189681-41189703 CTACAAAGCAAGTGGAGCAGGGG - Intronic
913456481 1:119036837-119036859 GAAAAAGCCAAGTGGAGCAATGG - Intronic
915837753 1:159191465-159191487 CTAAAACTAAAATGGGGAAAAGG - Intronic
916896066 1:169163199-169163221 CTAACACTGAAGTGGAGAAGAGG + Intronic
918136873 1:181681532-181681554 CAAAAACTAAAGAGGAGGAAGGG - Intronic
920331766 1:205213388-205213410 ATAAAATTCAAATGGTGCAAAGG + Intergenic
923360664 1:233207800-233207822 CTAAACCTTAAGTCAAGCAAAGG + Intronic
923476310 1:234334759-234334781 CTAAAACTCAAGAGAAGAAAAGG + Intergenic
923670474 1:236036456-236036478 ATAAAAGTCAACTGGAGGAATGG - Intronic
1063670022 10:8092796-8092818 CCAGAGCTGAAGTGGAGCAAAGG + Intergenic
1064594481 10:16929322-16929344 CTGAAACCAAAATGGAGCAAAGG + Intronic
1066692723 10:38046771-38046793 CTAAAACTTAAGTAGAGACACGG + Intronic
1068644308 10:59448936-59448958 CAGAAACACAATTGGAGCAAAGG + Intergenic
1070443416 10:76469090-76469112 CTAAAACTCAAAAGGAACAATGG + Intronic
1071713472 10:88072456-88072478 CTCAGACCCCAGTGGAGCAAGGG + Intergenic
1071796215 10:89008986-89009008 CTAAAACTTACTTGGTGCAAGGG - Exonic
1076169399 10:128307142-128307164 CTAAAGCTCAAGTGGACTAGAGG + Intergenic
1079697866 11:23506228-23506250 TTAAAACTAAAGTGTAGAAATGG - Intergenic
1081031281 11:38086902-38086924 CTAAAACTCAGATGGAGGAGAGG + Intergenic
1090840360 11:130482295-130482317 TTAAAAGTCAAGAGGAGCTAAGG - Intergenic
1093805877 12:23432373-23432395 CTCCGACTGAAGTGGAGCAAGGG + Intergenic
1099840369 12:87956995-87957017 CTAAAATTCATATGGAGCCATGG - Intergenic
1101700466 12:107169097-107169119 ATAAAATATAAGTGGAGCAAAGG + Intergenic
1103059328 12:117846242-117846264 TTAAAACTGAAGTGAAACAATGG - Intronic
1104068169 12:125322573-125322595 CTAAAACTAAATTGTGGCAATGG + Intronic
1106105160 13:26726566-26726588 CTAACACTCACATGGAGGAATGG + Intergenic
1106139343 13:26998505-26998527 CGAAGACTTAGGTGGAGCAAGGG - Intergenic
1108313324 13:49216500-49216522 CTGTAACTCATGTGGGGCAAGGG - Intergenic
1109436476 13:62310331-62310353 TTAAAAATCAAATGGTGCAAGGG - Intergenic
1110564373 13:76943220-76943242 ATAAAACTCAAGTGGAGACAAGG + Intergenic
1112180076 13:97069733-97069755 CTTAAAGTAAAGTGGAGCAGTGG - Intergenic
1115544464 14:34453228-34453250 CTAACCCCCAAGTGGATCAAGGG + Intronic
1117758487 14:59001002-59001024 GAAAAACTGAAGGGGAGCAAGGG + Intergenic
1120668350 14:87334450-87334472 CTAAAACTCAAGTGGAGGCTTGG + Intergenic
1121603411 14:95222947-95222969 CTAAAACAGAGGTGCAGCAACGG - Intronic
1122562729 14:102628364-102628386 CTAAATGTCAAGTGAAGAAAAGG - Intronic
1125884251 15:43216549-43216571 CTAAAACGTAAGTGGAGCCGAGG - Intronic
1135837435 16:25839405-25839427 CTAAAACAAAAATGGAGGAAGGG - Intronic
1135899595 16:26444640-26444662 ATGGAATTCAAGTGGAGCAATGG + Intergenic
1137568160 16:49547141-49547163 CAAAATCTCAAGGGGTGCAATGG + Intronic
1137814186 16:51382758-51382780 CTAAAACCCTAGTGGAGAATAGG - Intergenic
1143996135 17:11008053-11008075 CCAAAACACAAGCGGAGGAAAGG + Intergenic
1144820271 17:18068025-18068047 CACAAACTCCAGAGGAGCAAAGG + Exonic
1145829806 17:27906893-27906915 ATTAAACTTAAGTGGTGCAATGG + Intergenic
1146205466 17:30901403-30901425 TTCAAACTCAAGTGTAGCCAAGG + Intronic
1147517627 17:41136120-41136142 CTAAAACTCAACTGAAATAATGG - Intergenic
1149719596 17:58829847-58829869 CTAACAATCAAGTGGAGGAGTGG - Intronic
1153822116 18:8841048-8841070 ATAAAACCCAAGTGGGGAAAAGG + Intergenic
1156656487 18:39294551-39294573 CCAAAACACATGTGGATCAAAGG + Intergenic
1160330983 18:77991557-77991579 CTGAGACTGAATTGGAGCAAGGG + Intergenic
1165896643 19:39145535-39145557 CTCAAACCCACGTGGAGCAGGGG - Intronic
1167572997 19:50301809-50301831 CTTAGACTCAAGGGCAGCAATGG - Exonic
926197319 2:10771816-10771838 CTAAAAGGCAGGTGGAACAAAGG - Intronic
926383084 2:12310525-12310547 CTAAAACTGCAGAGAAGCAAAGG - Intergenic
929432091 2:41895806-41895828 CTAAAAGGCAAGAGGAGCAGAGG - Intergenic
930667771 2:54116123-54116145 CTAAAACTCAAGTCAAGCCCAGG - Intronic
935854271 2:107257827-107257849 CTTTAACTCAAGTGTAGCCACGG - Intergenic
937972735 2:127563250-127563272 CTGAAACCCAAGAGGAGGAAAGG - Intronic
938154846 2:128926291-128926313 CTAAAATCCAGGAGGAGCAAGGG - Intergenic
939712714 2:145542946-145542968 CTAAAACTCAACAGTAGGAAAGG - Intergenic
942828222 2:180206544-180206566 CTAAAAATCAGGTGGAGTAATGG - Intergenic
942968159 2:181922306-181922328 CTAAATCTGAAGTGGAAGAAGGG + Exonic
943645708 2:190406850-190406872 CTAAAACTCAAGTGGAGCAAAGG + Intergenic
943953002 2:194155017-194155039 ATAAAACTTAAGTGGGGAAAGGG - Intergenic
944518038 2:200531995-200532017 CTAAACCTCATGTGGAAAAAGGG - Intronic
945942344 2:215962137-215962159 CCAGAACTCAAGTGGAGCCGTGG - Intronic
947691283 2:232138775-232138797 CTAAAAATCAAGTTTAGCTAAGG + Intronic
948702306 2:239768047-239768069 CTAAAACTGGAGTGTGGCAATGG - Intronic
1168734757 20:123006-123028 CTAAAACTAAATTTGAGTAAAGG - Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1170557310 20:17525230-17525252 CTATAACCCAAGTGCAGCAGTGG + Intronic
1171321343 20:24247072-24247094 CAAGAACTCTAGTGGAGGAATGG - Intergenic
1178254026 21:31034240-31034262 TTAAAACAGAAATGGAGCAAGGG + Intergenic
1179435915 21:41361999-41362021 ATAAAAGTGAAGTGGAGGAAAGG + Exonic
1181371255 22:22419151-22419173 GTAAAACTTATGTGCAGCAAAGG + Intergenic
1184079301 22:42207269-42207291 CTAAAAGCCAAGTGGAGAAGAGG - Intronic
949183552 3:1164219-1164241 CTAAAACTGGAGTGGACCTAAGG - Intronic
951372404 3:21866531-21866553 ATCATACTCAACTGGAGCAAGGG + Intronic
951807455 3:26662127-26662149 ATCAAACTCAAGAGGAGTAAAGG - Intronic
953500934 3:43433413-43433435 CTCAAACTGAAGTGCAGCACAGG - Intronic
954915053 3:54141706-54141728 CTACAAATGAAGTGGAGAAATGG - Intronic
957007614 3:74968625-74968647 CTAAAACTAAACTGGATTAAAGG - Intergenic
959364148 3:105435702-105435724 CTAATACACAAGTGAAGCAATGG - Intronic
960783310 3:121344550-121344572 GTAAAACTAAAGTTAAGCAATGG + Intronic
962468544 3:135684197-135684219 CTAAAAATCCAGTGAAGAAACGG + Intergenic
962944243 3:140153090-140153112 GTTAAACTCCAGTGGAGAAAAGG + Intronic
964568405 3:158084753-158084775 TTAAATGTCAAATGGAGCAAAGG - Intergenic
965723167 3:171684288-171684310 TTAAAAATGAAGTGGAGGAAAGG - Intronic
966058611 3:175728131-175728153 CTATAGGTCAAGGGGAGCAATGG + Intronic
972516072 4:39811738-39811760 ATAAAAATCAAGAGGAGCAGAGG + Intergenic
974793960 4:66724817-66724839 CTGAAACTAAAGGAGAGCAAAGG + Intergenic
978551586 4:109933247-109933269 CTACAACTGCAGTGGAGCATGGG + Intronic
979801929 4:124920757-124920779 CTAAAAATCAAGTTGACTAAAGG - Intergenic
979816641 4:125114147-125114169 ATAAAACTCAAGTGGATGATAGG - Intergenic
980485190 4:133448384-133448406 CCAAAACTGAAGTGAAACAAAGG - Intergenic
984191501 4:176611864-176611886 CCAAAACTTAAGTGGAGGAGTGG + Intergenic
986323865 5:6657079-6657101 CTAAAACTTTAATGGAGAAAGGG + Intronic
987989628 5:25193655-25193677 CCAAAACTCAAGTGGAGAAGGGG - Intergenic
989827282 5:45872825-45872847 CTAAATTTCAAGTGGAGGGAAGG + Intergenic
990087891 5:52001422-52001444 CTAAAACTCAAGTGTGTCAGGGG + Intergenic
991774036 5:70066995-70067017 CTTAAAATCAATTGAAGCAATGG - Exonic
991853330 5:70942419-70942441 CTTAAAATCAATTGAAGCAATGG - Exonic
992990362 5:82277664-82277686 CTAAAACTTGACGGGAGCAATGG + Intronic
994204539 5:97019669-97019691 CTAAAACACAAAGGCAGCAATGG - Intronic
994316557 5:98339694-98339716 CTAACTCTCCAGAGGAGCAACGG - Intergenic
994468360 5:100169218-100169240 CCAAATCTGAAGTGGAGCACAGG - Intergenic
995130799 5:108628424-108628446 CTAAAAATCAAGTGGACCCAAGG + Intergenic
995159367 5:108959976-108959998 CTTAAACTGAAGTGGAATAATGG + Intronic
998379712 5:141715641-141715663 CTAAAAATACAGAGGAGCAAGGG - Intergenic
1000559520 5:162768476-162768498 CTAAGACTCAAGGGGAGACATGG - Intergenic
1004772912 6:18806038-18806060 CTAAAACTCAAATAGTGCAGAGG + Intergenic
1004987760 6:21102004-21102026 ATAAAGCTCAAGTGGGACAAAGG - Intronic
1005267890 6:24132175-24132197 CCAAAACTCATGTGTAGCTAAGG + Intronic
1005311500 6:24563618-24563640 CTACAACTCAAATGTAGAAATGG - Intronic
1005805585 6:29471515-29471537 CTAAAATTGAACTGGAGAAAGGG - Intergenic
1006606833 6:35263563-35263585 CTAAAACTAGAGTTGAGGAAAGG + Intronic
1007383734 6:41506607-41506629 TTAAAACTCAAGTGAAGCTTGGG - Intergenic
1009335518 6:62485181-62485203 ATAAAACTCAAGAAAAGCAAAGG + Intergenic
1009614951 6:65991710-65991732 CTACAACTCAAGTTGAGAATTGG + Intergenic
1010313608 6:74418831-74418853 CTAAAACTTATGTACAGCAAAGG - Intergenic
1010443551 6:75926408-75926430 CTACACCTCAAATGGAGAAAAGG - Intronic
1012390818 6:98737575-98737597 CTAAGACTCAAATGAAGAAAAGG - Intergenic
1014354004 6:120381430-120381452 CTAAAAATCAATATGAGCAAAGG + Intergenic
1016603428 6:145889946-145889968 CAAACACTGAAGTGGAGGAAGGG - Intronic
1017437835 6:154434269-154434291 CTAGAACTCATCTGTAGCAAAGG + Intronic
1020082256 7:5292590-5292612 CTAACTCTCAAATGGTGCAAGGG - Intronic
1022108267 7:27212375-27212397 CTAAGACTCAAGGGAAGCTAGGG + Intergenic
1025196670 7:56939557-56939579 CTAACTCTCAAATGGTGCAAGGG + Intergenic
1025675277 7:63637380-63637402 CTAACTCTCAAATGGTGCAAGGG - Intergenic
1032304975 7:130724167-130724189 CCAAAACTTGAGTGCAGCAAAGG - Intergenic
1032550726 7:132781612-132781634 CTCAAAATCAAGTGGGTCAAGGG + Intergenic
1036075162 8:5490611-5490633 GTAAAACTCCAGTGGAACAGAGG + Intergenic
1042136915 8:65641562-65641584 CTCACACTCAAGTGGAACAGGGG - Intergenic
1043497159 8:80814405-80814427 CTAAAACTCAAGTATAGTCATGG - Intronic
1043935195 8:86134421-86134443 AGAAAACTCAAGAGGAGAAAGGG - Intronic
1046524199 8:115363252-115363274 CTGAAACACAAGTGGAGAAGTGG + Intergenic
1049983397 9:925388-925410 CTAAAATTCAAGTTTTGCAAAGG - Intronic
1050068914 9:1790111-1790133 CCAAAATTAAAGTGGTGCAAAGG + Intergenic
1052138517 9:24946790-24946812 CTAAAACACAAGTAGTGTAAAGG - Intergenic
1052955878 9:34252989-34253011 CAAAAGCTCAAGTGGGACAATGG - Exonic
1055543445 9:77340644-77340666 CTAAAACAAAATTGGAGTAAGGG - Intronic
1056333400 9:85540744-85540766 CTAAAACACTGGTGAAGCAAAGG + Intergenic
1185689405 X:2140782-2140804 CCAAAGCTCAATTAGAGCAATGG - Intergenic
1189409802 X:40760141-40760163 CTAATATTCAAGGGGATCAAGGG + Intergenic
1194064483 X:89244629-89244651 CTAAAACAAATATGGAGCAATGG - Intergenic
1198025627 X:132703633-132703655 CTAAAACTTAATTAGAGTAAAGG - Intronic
1200718654 Y:6578711-6578733 CTAAAACAAATATGGAGCAATGG - Intergenic