ID: 943645979

View in Genome Browser
Species Human (GRCh38)
Location 2:190408348-190408370
Sequence CCAGCCCGTCGCAGCCCCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 146}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943645964_943645979 19 Left 943645964 2:190408306-190408328 CCACCCGGTCCGCATCCCTCGCC 0: 1
1: 0
2: 0
3: 13
4: 182
Right 943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 146
943645960_943645979 30 Left 943645960 2:190408295-190408317 CCTCCGTGGCCCCACCCGGTCCG 0: 1
1: 0
2: 0
3: 11
4: 145
Right 943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 146
943645963_943645979 20 Left 943645963 2:190408305-190408327 CCCACCCGGTCCGCATCCCTCGC 0: 1
1: 0
2: 0
3: 2
4: 88
Right 943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 146
943645966_943645979 15 Left 943645966 2:190408310-190408332 CCGGTCCGCATCCCTCGCCTCGC 0: 1
1: 0
2: 0
3: 3
4: 153
Right 943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 146
943645962_943645979 21 Left 943645962 2:190408304-190408326 CCCCACCCGGTCCGCATCCCTCG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 146
943645967_943645979 10 Left 943645967 2:190408315-190408337 CCGCATCCCTCGCCTCGCCTCGC 0: 1
1: 0
2: 3
3: 36
4: 593
Right 943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 146
943645970_943645979 -2 Left 943645970 2:190408327-190408349 CCTCGCCTCGCCGCGCCCCGCCC 0: 1
1: 19
2: 228
3: 537
4: 2152
Right 943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 146
943645961_943645979 27 Left 943645961 2:190408298-190408320 CCGTGGCCCCACCCGGTCCGCAT 0: 1
1: 0
2: 0
3: 10
4: 122
Right 943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 146
943645965_943645979 16 Left 943645965 2:190408309-190408331 CCCGGTCCGCATCCCTCGCCTCG 0: 1
1: 0
2: 0
3: 13
4: 81
Right 943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 146
943645969_943645979 3 Left 943645969 2:190408322-190408344 CCTCGCCTCGCCTCGCCGCGCCC 0: 1
1: 9
2: 39
3: 347
4: 1168
Right 943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 146
943645968_943645979 4 Left 943645968 2:190408321-190408343 CCCTCGCCTCGCCTCGCCGCGCC 0: 2
1: 1
2: 4
3: 60
4: 550
Right 943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 146
943645971_943645979 -7 Left 943645971 2:190408332-190408354 CCTCGCCGCGCCCCGCCCAGCCC 0: 1
1: 11
2: 236
3: 585
4: 2612
Right 943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943645979 Original CRISPR CCAGCCCGTCGCAGCCCCGG AGG Exonic
900246804 1:1640138-1640160 CCCGCCCGTCACTGCCCCAGTGG + Intronic
900258026 1:1707270-1707292 CCCGCCCGTCACTGCCCCAGTGG + Intronic
900568948 1:3348960-3348982 CCAGGCCAGCGCTGCCCCGGTGG - Intronic
900610812 1:3543906-3543928 CCAGCCCGCGTCAGCCCTGGAGG + Intronic
901373266 1:8818054-8818076 CCAGCCCGGCCCAGCCCGGGGGG - Intergenic
904247211 1:29196197-29196219 GCAGCCCGTCGTAGCCTCTGTGG - Exonic
904824442 1:33265431-33265453 ACAGCCCTTCCCAGCCCCGTGGG + Intronic
905451590 1:38060394-38060416 CCTGCCCTGGGCAGCCCCGGGGG - Intergenic
906225602 1:44119001-44119023 CCAGCCCCTGGCAGGCCGGGCGG + Intronic
911498773 1:98661535-98661557 CCAGCCCGCCCCAGGCCAGGTGG + Intergenic
912471857 1:109911684-109911706 CTAGCCCCAAGCAGCCCCGGGGG - Intronic
913644698 1:120845001-120845023 CCTGCCCGTTGCCGCCCCGCGGG - Intergenic
914082034 1:144418582-144418604 CCTGCCCGTTGCCGCCCCGCGGG + Intergenic
914099070 1:144568247-144568269 CCTGCCCGTTGCCGCCCCGCGGG - Intergenic
914176939 1:145287082-145287104 CCTGCCCGTTGCCGCCCCGCGGG + Intergenic
914299915 1:146369417-146369439 CCTGCCCGTTGCCGCCCCGCGGG + Intergenic
914531667 1:148528574-148528596 CCTGCCCGTTGCCGCCCCGCGGG + Intergenic
914636724 1:149559155-149559177 CCTGCCCGTTGCCGCCCCGCGGG - Intergenic
915127938 1:153678940-153678962 CCAGACCGTCGCAGCTACAGGGG + Exonic
917291553 1:173477094-173477116 CCACCTAGTCGCAGGCCCGGCGG + Intergenic
919843142 1:201623568-201623590 TCAGCCAGTCACAGCCACGGTGG + Intronic
1063295764 10:4804167-4804189 CCAGCCCTTTGGAGCCCCTGGGG - Intronic
1068690190 10:59906418-59906440 CCAGCCCGCCGCGGCCATGGCGG - Exonic
1074130389 10:110568164-110568186 CCCGCCCGCGGCCGCCCCGGCGG - Intronic
1075593432 10:123709309-123709331 CCAGCCCCTCACTGGCCCGGAGG + Intronic
1075616111 10:123891814-123891836 CCAGCCCAGCCCAGCCCCGCGGG - Exonic
1076594545 10:131617675-131617697 CCAGCCTCTCGCAGCCCAGGTGG + Intergenic
1077011732 11:381799-381821 GCAGCCCCTCCCAGCCCCGGTGG + Exonic
1077014698 11:394379-394401 CCGGCCCCTCGGCGCCCCGGCGG - Exonic
1077093954 11:791580-791602 CCTGCCCGGCCCAGGCCCGGGGG + Exonic
1077103733 11:833124-833146 CCTGCGCGCCCCAGCCCCGGAGG + Intronic
1077185636 11:1234272-1234294 CCAGCGTGTGGCAGCTCCGGAGG - Exonic
1077637950 11:3856027-3856049 TCAGGCCGCCGCAGCCCCGGCGG + Exonic
1079450434 11:20596687-20596709 CCAGCGCGCCGCAGCCAAGGAGG - Intergenic
1080012496 11:27472560-27472582 CCGGCCCGGCGCAGCGGCGGGGG + Exonic
1080858200 11:36130375-36130397 CCAGCCCCTTCCAGCCCCCGTGG - Intronic
1081647646 11:44800914-44800936 CCAGCCCCTCGCAGCCCAGGCGG - Intronic
1084175170 11:67419103-67419125 CCTCCCCGCAGCAGCCCCGGCGG - Exonic
1084204415 11:67583687-67583709 CCCGCCGGCCCCAGCCCCGGCGG - Exonic
1084317376 11:68353463-68353485 CCAGCCTGTCACAGCGCCCGCGG + Intronic
1084398097 11:68927850-68927872 CCAGCACCTGCCAGCCCCGGGGG - Intronic
1089273337 11:117316073-117316095 CCCGCCCCTCCCAGCCCCGCCGG - Exonic
1090788448 11:130069867-130069889 CCAGTTCGCCGCCGCCCCGGGGG - Intronic
1092564243 12:9648081-9648103 CGTCCCCGCCGCAGCCCCGGGGG - Intergenic
1101222813 12:102658282-102658304 CCATCCCATCACAGGCCCGGAGG - Intergenic
1102055038 12:109890129-109890151 CCAGGCCCTCTCAGCCCCTGAGG - Intergenic
1103562828 12:121800975-121800997 CCAGCCCGGCCCAGCCGCGACGG + Intronic
1103779713 12:123390101-123390123 TCCTCCCGTCGCAGCCCTGGAGG + Intronic
1112088211 13:96053540-96053562 GCAACCCGGCGCCGCCCCGGCGG - Intergenic
1113682544 13:112254472-112254494 CCAGCCAGGGCCAGCCCCGGAGG + Intergenic
1113877033 13:113601145-113601167 CCAGCCCTTCTCAGCTACGGAGG - Intronic
1114525633 14:23365691-23365713 CCAGACACTCGCACCCCCGGCGG + Intronic
1118265806 14:64294196-64294218 AGAGCCCGTCGCAGCTCGGGTGG + Exonic
1119862593 14:77947495-77947517 CCATCCCGTCACAGACCTGGAGG + Intergenic
1122081354 14:99269979-99270001 CCCGCCCGCCGCAGCCCGCGGGG - Intronic
1122408033 14:101512033-101512055 CCAGCCCCTCACAGACCCGTCGG + Intergenic
1122582115 14:102777537-102777559 CCAGCCGGCGGCAGCCGCGGCGG + Exonic
1122630294 14:103104537-103104559 CCTGCCCGTCGGCGCGCCGGGGG - Intronic
1122974728 14:105166408-105166430 CCAGCCCCTCGCCCCCACGGCGG - Intronic
1124848147 15:33311251-33311273 GCAGCCCCTCGCGGCCCCGCGGG - Intronic
1125047164 15:35255064-35255086 CCAGGCCATCGCATCCCCTGTGG - Intronic
1127766922 15:62195398-62195420 CCAGCCCAGCCCTGCCCCGGGGG + Intergenic
1131171932 15:90184971-90184993 CCGGCCCGGCGCAGCCCCTGGGG - Intronic
1131257561 15:90872046-90872068 CGAGCCGGCGGCAGCCCCGGTGG - Intronic
1132732598 16:1370223-1370245 CCAGCCCCTCCCAGGGCCGGTGG - Intronic
1133092291 16:3413896-3413918 CCAGCACGTCCCAGGCCCAGAGG - Intronic
1138589947 16:57994158-57994180 CCAGCCCGGCCCTGCCCCAGAGG - Intergenic
1139575917 16:67842150-67842172 CCAGCCCGTCTTGTCCCCGGCGG - Exonic
1139637087 16:68264395-68264417 CCAGGCCGTGGCGGCCACGGGGG + Intergenic
1139778055 16:69329641-69329663 CCAGCCTGACCCAGCCCAGGGGG - Intronic
1141701958 16:85646749-85646771 CCAGCCTGACGAAGCCCAGGGGG - Intronic
1142120399 16:88383844-88383866 CCAGCCCCGCGCACCCCCAGAGG + Intergenic
1142126062 16:88411332-88411354 AGAGCCCAACGCAGCCCCGGCGG + Intergenic
1142709194 17:1714515-1714537 TCCGCCCCTCACAGCCCCGGGGG - Intergenic
1143697602 17:8631384-8631406 CCAACCCCGCGCAGCCCCGGGGG - Intergenic
1147440392 17:40443855-40443877 CCAGCTCCTCGCAGCCCACGGGG - Exonic
1150489046 17:65561778-65561800 CCAGCCCCCCGCGGCCCCGAGGG + Intronic
1151539760 17:74758935-74758957 CCAGCCCATCCCAGCCTGGGTGG - Intronic
1152587144 17:81194199-81194221 CCAGCCTGTCTCAGGCCCAGAGG + Intronic
1152945431 17:83195238-83195260 CCAGCCCAGCCCAGCCCCGCAGG - Intergenic
1155902686 18:31410908-31410930 CAAGCCCGCAGCAGCCACGGCGG + Intronic
1160016236 18:75142851-75142873 CCAGCCCGACGCCGCCGAGGGGG - Intergenic
1160910342 19:1471071-1471093 TCGGCCCGGCGCAGCCGCGGCGG + Exonic
1162109858 19:8394095-8394117 CCAGCCCGCCACTGCCCCGCTGG + Intronic
1162975427 19:14205382-14205404 CCAGCCGGCCGCAGTCCGGGGGG - Intronic
1163158198 19:15450065-15450087 CCCCCCCCTCGCCGCCCCGGGGG + Intergenic
1163196921 19:15728454-15728476 CCAGGCAGGCGCAGCCCCGTGGG - Exonic
1163206551 19:15807605-15807627 CCAGGCAGGCGCAGCCCCGCGGG + Exonic
1163397166 19:17070363-17070385 CCAGCCTGTCTCAGCCCTGAAGG - Intronic
1163635071 19:18433840-18433862 CCGGCCCGACGCCGCCGCGGGGG - Intronic
1163666683 19:18606855-18606877 CCGGCCCGGCCCGGCCCCGGGGG + Intronic
1164634056 19:29779950-29779972 CCTGCCCCTCGCAGAACCGGTGG - Intergenic
1164644050 19:29845068-29845090 CCACCCCGCCGCAGGCCCCGCGG - Intergenic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1166702794 19:44891707-44891729 CCAGGCCATCGCAGCCCAGCGGG - Intronic
1166753995 19:45179447-45179469 CCAGCCACCCGCAGCCCCGTGGG - Exonic
927287162 2:21368972-21368994 CCAGCCAGTAGCAGACCCAGGGG + Intergenic
930358037 2:50346042-50346064 CCAGCCCTTCGCAGGCATGGAGG - Intronic
935046721 2:99489786-99489808 CCACCCCGCCGCCGGCCCGGGGG + Intronic
937978147 2:127593860-127593882 CCAGCCTGTGGAAGCCCAGGAGG + Intronic
938397730 2:130963498-130963520 CAGGCTCGTCGCAGCCGCGGTGG - Intronic
943645979 2:190408348-190408370 CCAGCCCGTCGCAGCCCCGGAGG + Exonic
947717918 2:232351167-232351189 GCAGCCCGGCCCAGCCCCGGTGG + Intergenic
948623327 2:239250490-239250512 CCAGCCAGTGGCAGCCCCAGTGG - Intronic
948890691 2:240905681-240905703 ACAGCCCCTGGCAGCCCCTGGGG + Intergenic
1169488455 20:6052623-6052645 CAAGGCCGTCGCATCCGCGGCGG + Exonic
1174486878 20:50866709-50866731 CCAGCCCCACACAGCTCCGGGGG + Intronic
1175814030 20:61874307-61874329 CCAGGCCGCCGCAGCCTGGGTGG - Intronic
1176178769 20:63740178-63740200 GCCGCCCGGCGCAGCCCCGGCGG - Intronic
1181172017 22:21015212-21015234 CCAGCCTGTCGTAGCCCCTGGGG - Exonic
1181439191 22:22927098-22927120 CCACCCCATCACAGCCCCAGTGG + Intergenic
1183392190 22:37552076-37552098 CCAGCCTGGCCCAGCCCTGGGGG - Intergenic
1183702478 22:39457929-39457951 CCAGCCCCGCGCCGCGCCGGAGG - Intronic
1184943999 22:47788151-47788173 CCAGCCAGTCCCTGCCCCAGTGG - Intergenic
1185164852 22:49255300-49255322 CCAGCCAGGCTCAGCCTCGGGGG + Intergenic
1185420191 22:50730755-50730777 TCAGCGCAGCGCAGCCCCGGGGG + Intergenic
950374180 3:12556881-12556903 CCAGCCAGGCTCCGCCCCGGAGG + Intronic
950487583 3:13282388-13282410 CCGGCTCGTCCGAGCCCCGGGGG + Intergenic
960120907 3:113947986-113948008 ACAGCCCGCCGCGGCCCGGGCGG - Exonic
960996343 3:123342922-123342944 CCAGCCCCGCGCAGCGCAGGAGG - Intronic
968879946 4:3293432-3293454 CCTGCCCGGCGCCGCCCCCGCGG - Intronic
985520537 5:372175-372197 CCAGCCCACCCCAGCCCTGGGGG - Intronic
985996594 5:3600457-3600479 CCACCCCGTAGCAGGCCCGCCGG - Intronic
994083233 5:95731231-95731253 GCAGCACGTGCCAGCCCCGGGGG - Exonic
994647813 5:102491791-102491813 CCAGCCTGCCGCAGCTCCGTGGG - Intronic
997303428 5:132822841-132822863 CCAGCCCGGCGCGGCCCCCAGGG - Exonic
997690722 5:135825882-135825904 CCAGCCCTGGGCAGCCCCTGAGG - Intergenic
1002181227 5:177432119-177432141 CCAGCCCTGCCCAGCCCCGCGGG + Intronic
1002415996 5:179121338-179121360 CGAGCCCGTCCCGGCCCGGGGGG - Intronic
1006770305 6:36547428-36547450 CCAGCCCGTCTCCGCGGCGGGGG - Exonic
1007431802 6:41780904-41780926 ACACCGCGTCCCAGCCCCGGAGG + Intronic
1013367164 6:109445117-109445139 CCAGCCCGTAGGAGTCCCAGTGG - Intronic
1015843692 6:137497063-137497085 CCGGCCCATCGCAGCCCCCTCGG - Intergenic
1019905042 7:4056515-4056537 CCAGCCGATCTCAGTCCCGGAGG - Intronic
1019934536 7:4245680-4245702 CCACCCCGGCCTAGCCCCGGCGG + Exonic
1022112399 7:27239661-27239683 CCAGGCCAGCCCAGCCCCGGCGG + Intergenic
1022363356 7:29685001-29685023 CCAGCCCGGCGGCGCCGCGGCGG - Intergenic
1026732749 7:72925562-72925584 GCAGCCCGCCGCCGCTCCGGAGG + Intronic
1029494395 7:100889385-100889407 CCAGGCCGTCGCAGCCGTAGTGG + Exonic
1030806772 7:113929497-113929519 CCTTCCCATCACAGCCCCGGAGG + Intronic
1033362437 7:140647128-140647150 CCAGCCCTTCGCAGCCAGGGAGG - Intronic
1036461865 8:8960435-8960457 CCATCCCATCACAGCCCCAGAGG - Intergenic
1037336971 8:17801265-17801287 CCACCCCCTGGCGGCCCCGGAGG - Intergenic
1040308250 8:46223413-46223435 CCAGCCAGTGACAGCCCTGGGGG - Intergenic
1040312349 8:46243302-46243324 CCTGCCCAGCGCAGCCCTGGGGG - Intergenic
1040330905 8:46385322-46385344 CCAGCCCGGGGCAGCCTTGGGGG - Intergenic
1040336529 8:46418872-46418894 CCAGCCCGGGACAGCCCTGGGGG - Intergenic
1042591579 8:70402989-70403011 CGGGCCCGTGTCAGCCCCGGGGG - Intronic
1047499336 8:125430005-125430027 CCAGCCCCTCCCAGCCCTGGGGG + Intergenic
1049752232 8:144290749-144290771 CCAGCCCCTCACAGCCCCCTCGG - Intronic
1057083629 9:92189859-92189881 CCAGCCCCTCGCAGGCTCCGGGG - Intergenic
1061043795 9:128153745-128153767 CCAGTCCATCGCAGACACGGTGG + Intergenic
1061515495 9:131087655-131087677 CCTGCCCCTGGCAGCCCGGGTGG + Intronic
1061527158 9:131175551-131175573 CCACCCCATCTCAGCCCCGCAGG + Exonic
1061589381 9:131588811-131588833 CCAGCCCCTGGCAGCCCGGGGGG - Exonic
1062354782 9:136156851-136156873 CCAGCCACTCGGGGCCCCGGGGG - Intergenic
1062443560 9:136584074-136584096 CCCGCCCCTCCCAGCTCCGGTGG - Intergenic
1062460078 9:136659329-136659351 CCAGCCCGTCCGAGGCCGGGGGG + Exonic
1189536156 X:41937189-41937211 CCAGCCAGAGGCAGCCCAGGAGG - Intergenic
1199772466 X:150983659-150983681 CCCGCCCGTGGCGGCCCCAGGGG + Intronic
1200787749 Y:7274447-7274469 CCAGCGCGTCGCAGTCCTGCAGG - Intergenic