ID: 943650737

View in Genome Browser
Species Human (GRCh38)
Location 2:190455087-190455109
Sequence CTCCAACTCCACCACTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943650737_943650738 -10 Left 943650737 2:190455087-190455109 CCTTCTGAGTGGTGGAGTTGGAG No data
Right 943650738 2:190455100-190455122 GGAGTTGGAGACTTTAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943650737 Original CRISPR CTCCAACTCCACCACTCAGA AGG (reversed) Intronic
No off target data available for this crispr