ID: 943657968

View in Genome Browser
Species Human (GRCh38)
Location 2:190529323-190529345
Sequence CAGTGGGCTGGGAGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943657968_943657975 -7 Left 943657968 2:190529323-190529345 CCACCTTCCCTCCCAGCCCACTG No data
Right 943657975 2:190529339-190529361 CCCACTGCTCCAGCCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943657968 Original CRISPR CAGTGGGCTGGGAGGGAAGG TGG (reversed) Intronic
No off target data available for this crispr