ID: 943679954

View in Genome Browser
Species Human (GRCh38)
Location 2:190758026-190758048
Sequence CTTCTTAACTGTAAGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943679954_943679956 19 Left 943679954 2:190758026-190758048 CCATTTTTCTTACAGTTAAGAAG No data
Right 943679956 2:190758068-190758090 GTGTAAGTCCTTTTCAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943679954 Original CRISPR CTTCTTAACTGTAAGAAAAA TGG (reversed) Intergenic
No off target data available for this crispr