ID: 943682435

View in Genome Browser
Species Human (GRCh38)
Location 2:190782607-190782629
Sequence CAGGGTCTGAGGTTGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943682435_943682441 -3 Left 943682435 2:190782607-190782629 CCCTCCAGCAACCTCAGACCCTG No data
Right 943682441 2:190782627-190782649 CTGTCACCTCACCCCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943682435 Original CRISPR CAGGGTCTGAGGTTGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr