ID: 943682441

View in Genome Browser
Species Human (GRCh38)
Location 2:190782627-190782649
Sequence CTGTCACCTCACCCCTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943682436_943682441 -4 Left 943682436 2:190782608-190782630 CCTCCAGCAACCTCAGACCCTGT No data
Right 943682441 2:190782627-190782649 CTGTCACCTCACCCCTCAGCAGG No data
943682432_943682441 6 Left 943682432 2:190782598-190782620 CCTCCTCCACCCTCCAGCAACCT No data
Right 943682441 2:190782627-190782649 CTGTCACCTCACCCCTCAGCAGG No data
943682433_943682441 3 Left 943682433 2:190782601-190782623 CCTCCACCCTCCAGCAACCTCAG No data
Right 943682441 2:190782627-190782649 CTGTCACCTCACCCCTCAGCAGG No data
943682437_943682441 -7 Left 943682437 2:190782611-190782633 CCAGCAACCTCAGACCCTGTCAC No data
Right 943682441 2:190782627-190782649 CTGTCACCTCACCCCTCAGCAGG No data
943682435_943682441 -3 Left 943682435 2:190782607-190782629 CCCTCCAGCAACCTCAGACCCTG No data
Right 943682441 2:190782627-190782649 CTGTCACCTCACCCCTCAGCAGG No data
943682434_943682441 0 Left 943682434 2:190782604-190782626 CCACCCTCCAGCAACCTCAGACC No data
Right 943682441 2:190782627-190782649 CTGTCACCTCACCCCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943682441 Original CRISPR CTGTCACCTCACCCCTCAGC AGG Intergenic