ID: 943685680

View in Genome Browser
Species Human (GRCh38)
Location 2:190815497-190815519
Sequence AGTCAGCCAGATCTCATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943685680_943685682 18 Left 943685680 2:190815497-190815519 CCACTCATGAGATCTGGCTGACT No data
Right 943685682 2:190815538-190815560 GCCCTAAGATACTGCAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943685680 Original CRISPR AGTCAGCCAGATCTCATGAG TGG (reversed) Intergenic
No off target data available for this crispr