ID: 943686900

View in Genome Browser
Species Human (GRCh38)
Location 2:190827972-190827994
Sequence AGGTCTTTACAGATTGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943686895_943686900 10 Left 943686895 2:190827939-190827961 CCAAGGGAGGATTAGAGAGGCTA No data
Right 943686900 2:190827972-190827994 AGGTCTTTACAGATTGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943686900 Original CRISPR AGGTCTTTACAGATTGTGCA AGG Intergenic
No off target data available for this crispr