ID: 943701959

View in Genome Browser
Species Human (GRCh38)
Location 2:190996525-190996547
Sequence GGTCTAGGAGGACCACTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943701952_943701959 -5 Left 943701952 2:190996507-190996529 CCTACAAGAGGCTCCTGTGGTCT No data
Right 943701959 2:190996525-190996547 GGTCTAGGAGGACCACTAGGGGG No data
943701951_943701959 -4 Left 943701951 2:190996506-190996528 CCCTACAAGAGGCTCCTGTGGTC No data
Right 943701959 2:190996525-190996547 GGTCTAGGAGGACCACTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943701959 Original CRISPR GGTCTAGGAGGACCACTAGG GGG Intronic
No off target data available for this crispr