ID: 943702812

View in Genome Browser
Species Human (GRCh38)
Location 2:191004788-191004810
Sequence TTTGTGTTCTTAAGGACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943702812_943702815 -7 Left 943702812 2:191004788-191004810 CCATTAGTCCTTAAGAACACAAA No data
Right 943702815 2:191004804-191004826 ACACAAAGATGGAACAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943702812 Original CRISPR TTTGTGTTCTTAAGGACTAA TGG (reversed) Intronic
No off target data available for this crispr