ID: 943704936

View in Genome Browser
Species Human (GRCh38)
Location 2:191024456-191024478
Sequence CTGCATTAGCAGTTCTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943704936_943704939 11 Left 943704936 2:191024456-191024478 CCAGACAAGAACTGCTAATGCAG No data
Right 943704939 2:191024490-191024512 CCATTCAAAAATTTTAAGTAGGG No data
943704936_943704937 10 Left 943704936 2:191024456-191024478 CCAGACAAGAACTGCTAATGCAG No data
Right 943704937 2:191024489-191024511 GCCATTCAAAAATTTTAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943704936 Original CRISPR CTGCATTAGCAGTTCTTGTC TGG (reversed) Intergenic
No off target data available for this crispr