ID: 943709531

View in Genome Browser
Species Human (GRCh38)
Location 2:191075522-191075544
Sequence CTGCCTCTTCCTGTATGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943709531_943709536 26 Left 943709531 2:191075522-191075544 CCAGAACATACAGGAAGAGGCAG No data
Right 943709536 2:191075571-191075593 GAGGTGATTACTATATTTCTAGG No data
943709531_943709534 4 Left 943709531 2:191075522-191075544 CCAGAACATACAGGAAGAGGCAG No data
Right 943709534 2:191075549-191075571 GGAATGACAGAAATTCAGCTTGG No data
943709531_943709535 7 Left 943709531 2:191075522-191075544 CCAGAACATACAGGAAGAGGCAG No data
Right 943709535 2:191075552-191075574 ATGACAGAAATTCAGCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943709531 Original CRISPR CTGCCTCTTCCTGTATGTTC TGG (reversed) Intronic
No off target data available for this crispr