ID: 943709534

View in Genome Browser
Species Human (GRCh38)
Location 2:191075549-191075571
Sequence GGAATGACAGAAATTCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943709531_943709534 4 Left 943709531 2:191075522-191075544 CCAGAACATACAGGAAGAGGCAG No data
Right 943709534 2:191075549-191075571 GGAATGACAGAAATTCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943709534 Original CRISPR GGAATGACAGAAATTCAGCT TGG Intronic
No off target data available for this crispr