ID: 943716265

View in Genome Browser
Species Human (GRCh38)
Location 2:191155416-191155438
Sequence CACTCTTGCCGCTGTAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943716258_943716265 27 Left 943716258 2:191155366-191155388 CCCAGTGGAGCTGCTTTTGTGGG No data
Right 943716265 2:191155416-191155438 CACTCTTGCCGCTGTAAGGGAGG No data
943716260_943716265 26 Left 943716260 2:191155367-191155389 CCAGTGGAGCTGCTTTTGTGGGA No data
Right 943716265 2:191155416-191155438 CACTCTTGCCGCTGTAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943716265 Original CRISPR CACTCTTGCCGCTGTAAGGG AGG Intergenic
No off target data available for this crispr