ID: 943720063

View in Genome Browser
Species Human (GRCh38)
Location 2:191194647-191194669
Sequence TGGGGTTCCTTGGGAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943720063_943720069 2 Left 943720063 2:191194647-191194669 CCTTTTCTTCCCAAGGAACCCCA No data
Right 943720069 2:191194672-191194694 GTTTTCAGAGAATAAAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943720063 Original CRISPR TGGGGTTCCTTGGGAAGAAA AGG (reversed) Intergenic
No off target data available for this crispr