ID: 943723970

View in Genome Browser
Species Human (GRCh38)
Location 2:191233641-191233663
Sequence TGGGCCCTGACCAAAATAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943723964_943723970 3 Left 943723964 2:191233615-191233637 CCTACAGTGGTTTCTGTTTTCTT No data
Right 943723970 2:191233641-191233663 TGGGCCCTGACCAAAATAGGGGG No data
943723960_943723970 27 Left 943723960 2:191233591-191233613 CCTGCATTAAACCCGTTTGAGAC No data
Right 943723970 2:191233641-191233663 TGGGCCCTGACCAAAATAGGGGG No data
943723961_943723970 16 Left 943723961 2:191233602-191233624 CCCGTTTGAGACACCTACAGTGG No data
Right 943723970 2:191233641-191233663 TGGGCCCTGACCAAAATAGGGGG No data
943723963_943723970 15 Left 943723963 2:191233603-191233625 CCGTTTGAGACACCTACAGTGGT No data
Right 943723970 2:191233641-191233663 TGGGCCCTGACCAAAATAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943723970 Original CRISPR TGGGCCCTGACCAAAATAGG GGG Intergenic
No off target data available for this crispr