ID: 943726335

View in Genome Browser
Species Human (GRCh38)
Location 2:191255427-191255449
Sequence GAATGTTTATTTCCTAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943726335_943726336 -6 Left 943726335 2:191255427-191255449 CCTGACTTAGGAAATAAACATTC No data
Right 943726336 2:191255444-191255466 ACATTCACACAGCTGCCTGAAGG No data
943726335_943726341 25 Left 943726335 2:191255427-191255449 CCTGACTTAGGAAATAAACATTC No data
Right 943726341 2:191255475-191255497 GTGTTAAAGAATGAGGAGGATGG No data
943726335_943726337 3 Left 943726335 2:191255427-191255449 CCTGACTTAGGAAATAAACATTC No data
Right 943726337 2:191255453-191255475 CAGCTGCCTGAAGGATGAGTTGG No data
943726335_943726339 18 Left 943726335 2:191255427-191255449 CCTGACTTAGGAAATAAACATTC No data
Right 943726339 2:191255468-191255490 TGAGTTGGTGTTAAAGAATGAGG No data
943726335_943726340 21 Left 943726335 2:191255427-191255449 CCTGACTTAGGAAATAAACATTC No data
Right 943726340 2:191255471-191255493 GTTGGTGTTAAAGAATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943726335 Original CRISPR GAATGTTTATTTCCTAAGTC AGG (reversed) Intronic