ID: 943726336

View in Genome Browser
Species Human (GRCh38)
Location 2:191255444-191255466
Sequence ACATTCACACAGCTGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943726335_943726336 -6 Left 943726335 2:191255427-191255449 CCTGACTTAGGAAATAAACATTC No data
Right 943726336 2:191255444-191255466 ACATTCACACAGCTGCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943726336 Original CRISPR ACATTCACACAGCTGCCTGA AGG Intronic