ID: 943726368

View in Genome Browser
Species Human (GRCh38)
Location 2:191255777-191255799
Sequence CTCAAAATGCAGAGGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943726368_943726379 18 Left 943726368 2:191255777-191255799 CCCTACCCCCTCTGCATTTTGAG No data
Right 943726379 2:191255818-191255840 CATTGGGTCCTGGCATCTGCTGG No data
943726368_943726377 8 Left 943726368 2:191255777-191255799 CCCTACCCCCTCTGCATTTTGAG No data
Right 943726377 2:191255808-191255830 CTGCTGCTGCCATTGGGTCCTGG No data
943726368_943726374 1 Left 943726368 2:191255777-191255799 CCCTACCCCCTCTGCATTTTGAG No data
Right 943726374 2:191255801-191255823 ATTGCCACTGCTGCTGCCATTGG No data
943726368_943726375 2 Left 943726368 2:191255777-191255799 CCCTACCCCCTCTGCATTTTGAG No data
Right 943726375 2:191255802-191255824 TTGCCACTGCTGCTGCCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943726368 Original CRISPR CTCAAAATGCAGAGGGGGTA GGG (reversed) Intronic
No off target data available for this crispr