ID: 943728569

View in Genome Browser
Species Human (GRCh38)
Location 2:191277741-191277763
Sequence GAATCAATGCCTCATTTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943728569_943728576 20 Left 943728569 2:191277741-191277763 CCAAAGAAATGAGGCATTGATTC No data
Right 943728576 2:191277784-191277806 GGAAACAGAATGTTTTGGATGGG No data
943728569_943728575 19 Left 943728569 2:191277741-191277763 CCAAAGAAATGAGGCATTGATTC No data
Right 943728575 2:191277783-191277805 AGGAAACAGAATGTTTTGGATGG No data
943728569_943728574 15 Left 943728569 2:191277741-191277763 CCAAAGAAATGAGGCATTGATTC No data
Right 943728574 2:191277779-191277801 GAGAAGGAAACAGAATGTTTTGG No data
943728569_943728571 -1 Left 943728569 2:191277741-191277763 CCAAAGAAATGAGGCATTGATTC No data
Right 943728571 2:191277763-191277785 CCCTGTACCTGCAGCTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943728569 Original CRISPR GAATCAATGCCTCATTTCTT TGG (reversed) Intronic
No off target data available for this crispr