ID: 943728573

View in Genome Browser
Species Human (GRCh38)
Location 2:191277770-191277792
Sequence TCTGTTTCCTTCTCAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943728573_943728577 5 Left 943728573 2:191277770-191277792 CCTGCAGCTGAGAAGGAAACAGA No data
Right 943728577 2:191277798-191277820 TTGGATGGGAGTAGTTTTAGTGG No data
943728573_943728576 -9 Left 943728573 2:191277770-191277792 CCTGCAGCTGAGAAGGAAACAGA No data
Right 943728576 2:191277784-191277806 GGAAACAGAATGTTTTGGATGGG No data
943728573_943728575 -10 Left 943728573 2:191277770-191277792 CCTGCAGCTGAGAAGGAAACAGA No data
Right 943728575 2:191277783-191277805 AGGAAACAGAATGTTTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943728573 Original CRISPR TCTGTTTCCTTCTCAGCTGC AGG (reversed) Intronic
No off target data available for this crispr