ID: 943728575

View in Genome Browser
Species Human (GRCh38)
Location 2:191277783-191277805
Sequence AGGAAACAGAATGTTTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943728572_943728575 -4 Left 943728572 2:191277764-191277786 CCTGTACCTGCAGCTGAGAAGGA No data
Right 943728575 2:191277783-191277805 AGGAAACAGAATGTTTTGGATGG No data
943728573_943728575 -10 Left 943728573 2:191277770-191277792 CCTGCAGCTGAGAAGGAAACAGA No data
Right 943728575 2:191277783-191277805 AGGAAACAGAATGTTTTGGATGG No data
943728570_943728575 -3 Left 943728570 2:191277763-191277785 CCCTGTACCTGCAGCTGAGAAGG No data
Right 943728575 2:191277783-191277805 AGGAAACAGAATGTTTTGGATGG No data
943728569_943728575 19 Left 943728569 2:191277741-191277763 CCAAAGAAATGAGGCATTGATTC No data
Right 943728575 2:191277783-191277805 AGGAAACAGAATGTTTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943728575 Original CRISPR AGGAAACAGAATGTTTTGGA TGG Intronic
No off target data available for this crispr