ID: 943729012

View in Genome Browser
Species Human (GRCh38)
Location 2:191282130-191282152
Sequence AGAGATTATACCCATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943729012_943729018 2 Left 943729012 2:191282130-191282152 CCCACCTCATGGGTATAATCTCT No data
Right 943729018 2:191282155-191282177 TCCTGGGAATTTGGCGTAGATGG No data
943729012_943729017 -7 Left 943729012 2:191282130-191282152 CCCACCTCATGGGTATAATCTCT No data
Right 943729017 2:191282146-191282168 AATCTCTGTTCCTGGGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943729012 Original CRISPR AGAGATTATACCCATGAGGT GGG (reversed) Intronic
No off target data available for this crispr