ID: 943738834

View in Genome Browser
Species Human (GRCh38)
Location 2:191388876-191388898
Sequence CTGTAAAAATAAAAAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943738834_943738837 12 Left 943738834 2:191388876-191388898 CCCTCCTTTTTTTATTTTTACAG No data
Right 943738837 2:191388911-191388933 ATCTTAATTAATAAACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943738834 Original CRISPR CTGTAAAAATAAAAAAAGGA GGG (reversed) Intronic
No off target data available for this crispr