ID: 943745135

View in Genome Browser
Species Human (GRCh38)
Location 2:191454365-191454387
Sequence GTGCACAGACAGAATGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943745134_943745135 3 Left 943745134 2:191454339-191454361 CCTATCATCACAACAATTGGCTT No data
Right 943745135 2:191454365-191454387 GTGCACAGACAGAATGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943745135 Original CRISPR GTGCACAGACAGAATGAGCT TGG Intergenic
No off target data available for this crispr