ID: 943745135 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:191454365-191454387 |
| Sequence | GTGCACAGACAGAATGAGCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 943745134_943745135 | 3 | Left | 943745134 | 2:191454339-191454361 | CCTATCATCACAACAATTGGCTT | No data | ||
| Right | 943745135 | 2:191454365-191454387 | GTGCACAGACAGAATGAGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 943745135 | Original CRISPR | GTGCACAGACAGAATGAGCT TGG | Intergenic | ||
| No off target data available for this crispr | |||||