ID: 943745680

View in Genome Browser
Species Human (GRCh38)
Location 2:191460646-191460668
Sequence AGACCCTGCCTGACAAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943745680_943745684 10 Left 943745680 2:191460646-191460668 CCCCTCTTTGTCAGGCAGGGTCT No data
Right 943745684 2:191460679-191460701 CATAGATACAAATTTACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943745680 Original CRISPR AGACCCTGCCTGACAAAGAG GGG (reversed) Intergenic
No off target data available for this crispr