ID: 943753654

View in Genome Browser
Species Human (GRCh38)
Location 2:191536275-191536297
Sequence GAGTGTTTTCCCTGGCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943753654_943753662 11 Left 943753654 2:191536275-191536297 CCAGGGTGCCAGGGAAAACACTC No data
Right 943753662 2:191536309-191536331 AGGGTATTTTTAATTTTCCAGGG No data
943753654_943753661 10 Left 943753654 2:191536275-191536297 CCAGGGTGCCAGGGAAAACACTC No data
Right 943753661 2:191536308-191536330 CAGGGTATTTTTAATTTTCCAGG No data
943753654_943753659 -9 Left 943753654 2:191536275-191536297 CCAGGGTGCCAGGGAAAACACTC No data
Right 943753659 2:191536289-191536311 AAAACACTCAGGGGCACTGCAGG No data
943753654_943753660 -8 Left 943753654 2:191536275-191536297 CCAGGGTGCCAGGGAAAACACTC No data
Right 943753660 2:191536290-191536312 AAACACTCAGGGGCACTGCAGGG No data
943753654_943753663 19 Left 943753654 2:191536275-191536297 CCAGGGTGCCAGGGAAAACACTC No data
Right 943753663 2:191536317-191536339 TTTAATTTTCCAGGGAAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943753654 Original CRISPR GAGTGTTTTCCCTGGCACCC TGG (reversed) Intergenic
No off target data available for this crispr