ID: 943757660

View in Genome Browser
Species Human (GRCh38)
Location 2:191573695-191573717
Sequence CCTCATTAGCCCCAGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943757655_943757660 9 Left 943757655 2:191573663-191573685 CCTGAAGCCAGATAGTTCTTAGG No data
Right 943757660 2:191573695-191573717 CCTCATTAGCCCCAGGAGACTGG No data
943757657_943757660 2 Left 943757657 2:191573670-191573692 CCAGATAGTTCTTAGGAATCAAT No data
Right 943757660 2:191573695-191573717 CCTCATTAGCCCCAGGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943757660 Original CRISPR CCTCATTAGCCCCAGGAGAC TGG Intergenic
No off target data available for this crispr