ID: 943765712

View in Genome Browser
Species Human (GRCh38)
Location 2:191659484-191659506
Sequence TGGGTTGCTAGTGGTTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943765706_943765712 2 Left 943765706 2:191659459-191659481 CCCTTAAGGTTAGCTGGCATATA No data
Right 943765712 2:191659484-191659506 TGGGTTGCTAGTGGTTGGCCTGG No data
943765704_943765712 15 Left 943765704 2:191659446-191659468 CCATTAAACTTCACCCTTAAGGT No data
Right 943765712 2:191659484-191659506 TGGGTTGCTAGTGGTTGGCCTGG No data
943765707_943765712 1 Left 943765707 2:191659460-191659482 CCTTAAGGTTAGCTGGCATATAG No data
Right 943765712 2:191659484-191659506 TGGGTTGCTAGTGGTTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943765712 Original CRISPR TGGGTTGCTAGTGGTTGGCC TGG Intergenic