ID: 943767343

View in Genome Browser
Species Human (GRCh38)
Location 2:191677630-191677652
Sequence GGTACCAAGGGAAAACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943767343 Original CRISPR GGTACCAAGGGAAAACAGGC TGG (reversed) Intergenic
901183626 1:7358192-7358214 GGTACCAGAGGAAAAAAGGGAGG - Intronic
901364119 1:8730774-8730796 AGTACAAAGGGGAAACTGGCTGG - Intronic
901680647 1:10910766-10910788 GGTGCCAAGGGACACCAAGCAGG + Intergenic
902730366 1:18365024-18365046 GGTACAATGGGAACACATGCAGG - Intronic
903289219 1:22297317-22297339 GGTTCCCAAGGAAAAGAGGCAGG - Intergenic
903788223 1:25875334-25875356 GGGACCCGGGGAAGACAGGCAGG - Intergenic
907765439 1:57406001-57406023 GGAACCAGGGGAAATGAGGCAGG - Intronic
907844915 1:58196295-58196317 GGTCCCAGGAGGAAACAGGCTGG + Intronic
908088018 1:60657474-60657496 AGTAACAAGGGAAAAGAGGAAGG + Intergenic
910378238 1:86596537-86596559 GGATACAAGGGAAAACAGGCAGG - Intergenic
910778300 1:90898698-90898720 GGAACTAAGGGAAAACATGGAGG + Intergenic
911457292 1:98141585-98141607 GGTACCAAGGTATAACAGGAAGG - Intergenic
914679555 1:149929601-149929623 GGTAAGAAGGGAAAATAGACTGG - Exonic
917404537 1:174690579-174690601 GGGACCAAAAGAAAACTGGCTGG - Intronic
922078195 1:222268523-222268545 GGTACCAAGCGCATCCAGGCAGG + Intergenic
924631408 1:245744182-245744204 GATACCAAGGGAAAACTGTATGG + Intergenic
1063252880 10:4293449-4293471 GGTAACCAGGGAAAAGAAGCAGG - Intergenic
1065674402 10:28158591-28158613 GGTGACAAGGGAAATGAGGCAGG + Intronic
1067364182 10:45609820-45609842 GTTAACAAGAGAAAACAGGTTGG + Intergenic
1069728621 10:70597255-70597277 GCAACCCAGTGAAAACAGGCTGG - Intergenic
1072351166 10:94558895-94558917 GAGAGTAAGGGAAAACAGGCTGG - Intronic
1073816440 10:107213010-107213032 GGCAGCCAGAGAAAACAGGCAGG - Intergenic
1078721088 11:13883702-13883724 GGTGCCACTGGAAAACTGGCTGG + Intergenic
1078906689 11:15694166-15694188 GGTACCAACGAAAAACCTGCTGG - Intergenic
1080308144 11:30858884-30858906 GGTACCTGGGGAAGACAGGCAGG - Intronic
1080470729 11:32543113-32543135 GCTAGCCAGGGAAAAGAGGCTGG + Intergenic
1081337301 11:41882556-41882578 GGATCAAAGGGAAAAAAGGCAGG - Intergenic
1081727296 11:45339460-45339482 GATGGCAAGGGAATACAGGCAGG + Intergenic
1083111132 11:60408467-60408489 GGTACCAGGGGCAATCAGGAGGG - Intronic
1083876168 11:65525362-65525384 GGAACCAAGGGGTAGCAGGCCGG + Intronic
1084164332 11:67367986-67368008 GGTACAACTGGAACACAGGCAGG - Intronic
1088801733 11:113313156-113313178 GTTACCAATGGAAAAAAAGCAGG - Intergenic
1091204401 11:133809870-133809892 GGTACTATGGGATGACAGGCGGG - Intergenic
1091406093 12:210449-210471 GGTAGCAAGGGTCAACGGGCAGG + Exonic
1093160547 12:15741416-15741438 GGTACCAAGCGAATCCTGGCAGG + Intronic
1096880152 12:54660746-54660768 GCTACCAAGGGACAACAGGCAGG - Intergenic
1098291271 12:68958819-68958841 GTTACCAAGGGATGAGAGGCAGG - Intronic
1101337659 12:103810596-103810618 GGTACTAAAGGAAACCAGACTGG - Intronic
1105712201 13:23022341-23022363 CGAACCCAAGGAAAACAGGCTGG - Intergenic
1107102265 13:36606295-36606317 GCCACCATGGGAACACAGGCAGG - Intergenic
1107362761 13:39637845-39637867 GGGAACAAGGGAAAGCAGGGGGG - Intergenic
1109813061 13:67540924-67540946 GGTACCCAGGGTAAAGAGGACGG - Intergenic
1110866851 13:80406128-80406150 GGTAGCTAGAGAGAACAGGCAGG - Intergenic
1111971122 13:94917944-94917966 GCAAACAAGAGAAAACAGGCTGG + Intergenic
1112007441 13:95266399-95266421 CATACCAAGGGAACACAGCCTGG + Intronic
1117337381 14:54766906-54766928 GGTACCAAGGGAGGACATGCAGG - Intronic
1118280670 14:64425505-64425527 GTTAGAAAGGGAAAACAGGCCGG - Intronic
1122943544 14:104994417-104994439 GGCGCCCAGGGAAAACATGCTGG - Intronic
1123949285 15:25254602-25254624 GGTAACAAGGAATAACAGGTAGG + Intergenic
1127967698 15:63935553-63935575 GGTACCAAGACAAAGCAGTCAGG - Intronic
1128364389 15:66987040-66987062 GGTCCCAAAGAAAAACAAGCTGG + Intergenic
1128724875 15:69981109-69981131 GATACCAATGGGAAACAGCCTGG - Intergenic
1129498378 15:76010054-76010076 GGTACCAAGGGAGAAAGGGAAGG - Intronic
1129797251 15:78387196-78387218 GGTATCAAGGGGAGACAAGCTGG + Intergenic
1130184010 15:81661650-81661672 GGCATCAAAGGAAAACAGGTTGG + Intergenic
1130188309 15:81707520-81707542 GGCATCAAAGGAAAACAGGTTGG + Intergenic
1130701185 15:86183974-86183996 GCTACCAAGAGATGACAGGCAGG - Intronic
1137974967 16:53023505-53023527 GGCACCATGGGAGGACAGGCTGG + Intergenic
1139687118 16:68612695-68612717 GGTACCTGGGGAAGACATGCTGG - Intergenic
1139945216 16:70636354-70636376 TGAACCAAAGGAAAACATGCAGG - Intronic
1141956917 16:87378558-87378580 GGTACAAAGGGAAATCACTCTGG + Intronic
1142632967 17:1237623-1237645 GTTAATAATGGAAAACAGGCTGG - Intergenic
1143850861 17:9810871-9810893 GGAACCAAGGGAAAAGACACTGG - Intronic
1144663231 17:17085088-17085110 GGTCGCAAGGGAAAGGAGGCAGG + Intronic
1146258803 17:31408077-31408099 GGTAACAAGGTATGACAGGCTGG - Intronic
1146635718 17:34502889-34502911 CCTACCAAGGGAGAAAAGGCTGG + Intergenic
1146950099 17:36899836-36899858 GGGAACAGGGGAAGACAGGCTGG + Intergenic
1148573736 17:48692396-48692418 AGTAGCAAGGAACAACAGGCAGG - Intergenic
1149373781 17:56023015-56023037 GATACCAAGAGAGAAAAGGCAGG - Intergenic
1150268640 17:63848183-63848205 GGTACCATGGGGAAACAAGGAGG + Intergenic
1151105964 17:71617696-71617718 GCTACCAAGGGAGAACAGTATGG - Intergenic
1151600767 17:75104796-75104818 GGTACCCAAGGAAAAAAGTCCGG - Intronic
1152122055 17:78424885-78424907 GGGTTCAAGGGAAAAGAGGCTGG - Intronic
1152634993 17:81427221-81427243 GGCAGCAAGGGGAAACAGGGGGG + Intronic
1153775701 18:8451429-8451451 GGGAACAAAGGAAGACAGGCTGG - Intergenic
1154315387 18:13299979-13300001 GGCACCAGGGGAACACAGGTGGG - Intronic
1156966712 18:43103157-43103179 GGTACCAAGAGAGAAGTGGCAGG - Intronic
1159169156 18:64741082-64741104 GCTAGCAAGGGAAGAAAGGCTGG + Intergenic
1161372163 19:3918860-3918882 GGCACCAGTGGAAAACAGGTAGG + Exonic
1161493390 19:4575010-4575032 GGCTCCAAGGGAATCCAGGCTGG + Intergenic
1163127283 19:15251167-15251189 GGGAGCAACGGAACACAGGCAGG - Intronic
1163411013 19:17154501-17154523 GCAACCCAGTGAAAACAGGCAGG + Intronic
1163689960 19:18733158-18733180 GGCACTAAGGGAAGACAGGAGGG - Intronic
1166818019 19:45558491-45558513 GGCGCTAGGGGAAAACAGGCTGG - Intronic
1167064487 19:47174078-47174100 GGAATTAAGGGTAAACAGGCTGG - Intronic
1167513528 19:49909616-49909638 GGTGGCAAGTGAGAACAGGCCGG + Exonic
1168138858 19:54371149-54371171 GGTAGGAGGGGGAAACAGGCTGG - Intergenic
1168159166 19:54497353-54497375 GGTAGGAGGGGGAAACAGGCTGG + Intergenic
1168511069 19:56973954-56973976 GGTCTTTAGGGAAAACAGGCTGG + Intergenic
1168559537 19:57371447-57371469 GTTTCCAAGGGAAACAAGGCAGG + Intronic
930169887 2:48240657-48240679 GGTACAAATGCAATACAGGCTGG + Intergenic
930304910 2:49665661-49665683 GGTTCCCAGGGAAGAGAGGCTGG + Intergenic
931350663 2:61485174-61485196 GTTAACAAGAGAAAATAGGCTGG - Intronic
932569375 2:72930321-72930343 GGTACTAAGGAACTACAGGCAGG + Intronic
934234393 2:90217375-90217397 GGTACCAAAGGAGAAGAGGATGG - Intergenic
935089579 2:99881974-99881996 GGCACCCAGGAAAAACACGCTGG + Intronic
943767343 2:191677630-191677652 GGTACCAAGGGAAAACAGGCTGG - Intergenic
945176418 2:207048150-207048172 TGTACCCAGGGAGGACAGGCTGG + Intergenic
948068148 2:235097478-235097500 GGCACCTAGGGAGAACATGCTGG + Intergenic
948422528 2:237869132-237869154 CGTGCCCAGGGAAAGCAGGCAGG - Intronic
1172097500 20:32467547-32467569 GGGACCAAGGGAGACCAGGCTGG + Intronic
1172307203 20:33889156-33889178 GGGCCCAGAGGAAAACAGGCAGG - Intergenic
1174792463 20:53493031-53493053 TGTACTCAGGGAAAACAGCCTGG - Exonic
1175664084 20:60843603-60843625 GAGGCCAAGGGAAAACTGGCAGG + Intergenic
1176032419 20:63019240-63019262 AGTACAAAGGGCAAGCAGGCGGG - Intergenic
1176425810 21:6547594-6547616 GCTTCCAAGGGAAAGCAGGGAGG - Intergenic
1178378393 21:32087723-32087745 GTTACAAGGGGAAAAGAGGCAGG - Intergenic
1179701301 21:43155911-43155933 GCTTCCAAGGGAAAGCAGGGAGG - Intergenic
1180690053 22:17706304-17706326 GGTAGAAAGAGAAAACAGGCTGG - Intronic
1183058953 22:35323651-35323673 GGAACCAAGGGAAGGGAGGCAGG + Intronic
1185080356 22:48706230-48706252 GGACCCAAAGGAAAACAGGAAGG + Intronic
949489195 3:4571628-4571650 GGTAAGAAGTGAAATCAGGCCGG - Intronic
951162419 3:19441011-19441033 GGAACCAAGGGAAGACTGGCAGG + Intronic
952015769 3:28955435-28955457 GGTTCCCAGGGATAGCAGGCAGG + Intergenic
953612017 3:44454986-44455008 GGTACCATGGGAAGAAAGGAAGG + Intronic
956608755 3:71100506-71100528 GATACCAATGGAAAAGAAGCAGG + Intronic
962875765 3:139535135-139535157 GGTTCCCATGGAAAAGAGGCAGG + Intronic
964310698 3:155388617-155388639 GGCACCACGGGAATTCAGGCAGG - Intronic
965688897 3:171334240-171334262 GAGAGCAAGGGCAAACAGGCAGG - Intronic
965831126 3:172790350-172790372 CCTACCAAGGGAAGAAAGGCTGG + Intronic
965984681 3:174736792-174736814 GGTGGCAAGGGAAGACAGACAGG - Intronic
966886169 3:184379284-184379306 GGAACCAAGAGAAAGGAGGCTGG + Intronic
966920380 3:184607354-184607376 GGTACTAAATGAAAACAGGAAGG + Intronic
967401673 3:189069808-189069830 AATACAAAGGAAAAACAGGCTGG + Intronic
967956591 3:194881900-194881922 GGTTCCAAGGGAATGCAGGGAGG - Intergenic
968153628 3:196359615-196359637 GATAACAAAGCAAAACAGGCCGG + Intronic
969990755 4:11260083-11260105 GGTTCCCTGGGAAAACAGGATGG + Intergenic
970350822 4:15200430-15200452 GTTATCAAGAGAAAAAAGGCAGG - Intergenic
972226066 4:37013548-37013570 GGTACCAAGGGAATTCAGTAGGG + Intergenic
972737112 4:41853548-41853570 GGTAGAATGGGAAAACAGCCTGG - Intergenic
977744836 4:100534709-100534731 TGGACCAAGGGCAAAGAGGCTGG - Intronic
978621143 4:110635277-110635299 GGAACCATGGCAAAGCAGGCAGG + Intronic
978827255 4:113040446-113040468 GGTATAAAGCGAAAACAAGCAGG + Intronic
985215997 4:187655253-187655275 GTCACCATGGAAAAACAGGCAGG - Intergenic
985947429 5:3197290-3197312 GGGAAGAAGGGAAAACAGTCGGG - Intergenic
989306885 5:39968244-39968266 TGAACAAATGGAAAACAGGCAGG + Intergenic
990247200 5:53874698-53874720 GGTAACAAGGGCAAGGAGGCTGG + Intergenic
991963454 5:72068115-72068137 TGTTCCAAGGGAATACAGGAAGG + Intergenic
992641649 5:78773165-78773187 GGTAAAAAACGAAAACAGGCCGG + Intergenic
995519861 5:112992688-112992710 GGTACCTAGCAAAATCAGGCTGG + Exonic
997145023 5:131423140-131423162 GGTACCGAGGGAAAACTGTGAGG + Intergenic
999089785 5:148926144-148926166 GGAAACAAGGAAAAACAGACAGG + Intronic
999401196 5:151265555-151265577 GGTATCAAGGGAAAACTCTCAGG - Intronic
1001281104 5:170387035-170387057 GGAACCATGGGAAATCACGCGGG - Intronic
1001515197 5:172350568-172350590 GGTACCAGGGCAAAGAAGGCTGG - Exonic
1001716969 5:173824306-173824328 GCTACAAAAGGAAAACAGGTTGG - Intergenic
1001968097 5:175928567-175928589 AGTACTAAGGAAAAACAGTCAGG + Intronic
1002249345 5:177915239-177915261 AGTACTAAGGAAAAACAGTCAGG - Intergenic
1005440985 6:25868493-25868515 GGCACCAAGGAAAAAAAAGCTGG + Intronic
1007903435 6:45434244-45434266 GGTACAAAGGGTACAAAGGCAGG - Intronic
1008257860 6:49326311-49326333 GGAACTAAGAGGAAACAGGCAGG + Intergenic
1009428212 6:63537894-63537916 CCTACCAATGGAATACAGGCAGG + Intronic
1011115437 6:83885804-83885826 GGTAAGAATGGAAAACAGTCTGG + Intronic
1012198746 6:96378379-96378401 GGCATCAAGAGAAAACAGGAAGG - Intergenic
1012745919 6:103088519-103088541 GGTGCCAAGGAAAAACTGGAAGG - Intergenic
1016289019 6:142507149-142507171 GATTCCAAGGGAAGAGAGGCTGG + Intergenic
1022980562 7:35601455-35601477 AGAAAAAAGGGAAAACAGGCTGG - Intergenic
1027264367 7:76485960-76485982 AGCACCAAGGGAAGACAGACTGG - Intronic
1027315737 7:76984074-76984096 AGCACCAAGGGAAGACAGACTGG - Intergenic
1028748628 7:94356493-94356515 GGAACCAAGGGAAATGAAGCAGG + Intergenic
1029346982 7:99985889-99985911 GGGACCAAGGGGACTCAGGCTGG - Intergenic
1029670189 7:102024764-102024786 GGTAACAAGGGAAAAGAGTGTGG - Intronic
1029933240 7:104395984-104396006 GGTACCAATGGCAAAAAGGCAGG + Intronic
1030093642 7:105878337-105878359 GATTCCTTGGGAAAACAGGCAGG + Intronic
1030319937 7:108155561-108155583 GGTACCAAGGGAACAGAAGCAGG - Intronic
1033593118 7:142831298-142831320 GGAACCAAGTCAAAACAGCCAGG + Intergenic
1033930717 7:146517164-146517186 CTTACCAAGTGAAAACAGGCAGG - Intronic
1034314034 7:150113060-150113082 GGTACCAAGGGGAAACAGATGGG + Intergenic
1034524216 7:151645968-151645990 GGTACCAAGGGAATCCAGTGAGG - Intronic
1036604844 8:10295692-10295714 GGTGCCAAGTGACCACAGGCTGG - Intronic
1037816328 8:22114662-22114684 GCCACCAAGGGCAGACAGGCGGG + Exonic
1038163682 8:25064302-25064324 GGCACCATGGGAAAAAGGGCTGG - Intergenic
1038883453 8:31639422-31639444 GGCACCACAGGTAAACAGGCTGG + Intronic
1039910922 8:41826297-41826319 TGTCCCCAGAGAAAACAGGCTGG + Intronic
1041129180 8:54679022-54679044 GGTTCCATAGGAAAAGAGGCAGG - Intergenic
1046864434 8:119130104-119130126 TGTACCAAGCAAAAACAGCCAGG - Intergenic
1047222778 8:122931845-122931867 GGGCCCAAGAGAAACCAGGCAGG + Intronic
1048162917 8:132037551-132037573 GGTCTCAAAGGAAAACAGGCTGG + Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1048813188 8:138307054-138307076 GGTGCCAAGGTTAAACAGGAGGG - Intronic
1051698548 9:19794552-19794574 GGTTCCAGAGGTAAACAGGCAGG - Intergenic
1053567282 9:39266653-39266675 CGTACCAAGGGAAACCCAGCAGG + Intronic
1054129861 9:61352345-61352367 CGTACCAAGGGAAACCCAGCAGG - Intergenic
1055696413 9:78889655-78889677 TATTGCAAGGGAAAACAGGCTGG - Intergenic
1060354158 9:122888436-122888458 GGAATCAAGGGAAAGCAGACAGG - Intronic
1061556962 9:131376596-131376618 GTTAACAAGGAAACACAGGCCGG - Intergenic
1061984600 9:134122901-134122923 GATACTAAGGGAAATCAGCCAGG + Intergenic
1187469263 X:19553484-19553506 TGTTCCTAGGGAAAACATGCTGG + Intronic
1188522401 X:31053414-31053436 GTTACCAAGGGAAATGAAGCAGG + Intergenic
1189784038 X:44543213-44543235 GGTACAAAGGGAGAACCAGCTGG + Intergenic
1190059436 X:47201417-47201439 GGTACCAAGAGCAGACAGGAAGG - Intronic
1200110180 X:153736984-153737006 GGTCCCTAGGGAACACAGCCAGG - Intronic