ID: 943768301

View in Genome Browser
Species Human (GRCh38)
Location 2:191687309-191687331
Sequence ATGAATATGCATATGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 424}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943768301_943768302 -10 Left 943768301 2:191687309-191687331 CCTTTGTTCATATGCATATTCAT 0: 1
1: 0
2: 2
3: 47
4: 424
Right 943768302 2:191687322-191687344 GCATATTCATGATTATAATTTGG 0: 1
1: 0
2: 1
3: 29
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943768301 Original CRISPR ATGAATATGCATATGAACAA AGG (reversed) Intronic
900075243 1:810104-810126 ATGAATATGCATCCAAAAAAAGG - Intergenic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
901673729 1:10870665-10870687 ATGAATATCCAAATGAATGAAGG - Intergenic
902342820 1:15795478-15795500 ATGAATGTGCAAATGAAAACTGG - Intergenic
902563427 1:17293745-17293767 ATGAATATCCATAGCAACATTGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903546731 1:24128795-24128817 ATGAATATGGAAGTGAACAGGGG - Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904994856 1:34623663-34623685 ATGACCATGCATTTGAACAGAGG + Intergenic
905116385 1:35644688-35644710 ATGAATATTGGTATGTACAAAGG - Intergenic
905163252 1:36056225-36056247 ATATATATGCATATGAAGTATGG - Exonic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
906088205 1:43154593-43154615 TTGAATATAAATATGAATAATGG + Intronic
906790012 1:48650824-48650846 TTGAATATGCTTATAAACATAGG - Intronic
908364251 1:63401681-63401703 AGAAATAAGCTTATGAACAATGG + Intronic
910625733 1:89304378-89304400 CTGAATGTCCATATGCACAATGG - Intergenic
910772390 1:90843209-90843231 CTGATTATGTATATGAACACTGG - Intergenic
910895334 1:92063781-92063803 ATGAATATGCATTTTTAAAATGG + Intergenic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
912039165 1:105364103-105364125 ATGATTATGTATATAAACACTGG - Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
914974599 1:152349687-152349709 ATGAATATGTCCAAGAACAAAGG - Exonic
915775231 1:158476700-158476722 ATGAATATGAATAAGATGAAAGG + Intergenic
915793483 1:158701320-158701342 AAGAATATACATATGAAGAGAGG - Intergenic
916555426 1:165890577-165890599 TTGAATCTGTATCTGAACAAAGG + Intronic
916601736 1:166299709-166299731 ATGAATATTCAAAGGAATAAGGG + Intergenic
916790757 1:168122982-168123004 ATGAATAAATATAGGAACAATGG + Intronic
917169791 1:172158391-172158413 ATGAAGAAGCATATGAAAAAAGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917637984 1:176955606-176955628 ATGAATATGCATTTGCAATAAGG - Intronic
918185822 1:182126838-182126860 ATGAATAAGTCTATGAAAAATGG - Intergenic
918306183 1:183249190-183249212 TTGAATGTACATAGGAACAAGGG - Exonic
918974809 1:191469823-191469845 ATAAATATGGAAATCAACAATGG + Intergenic
919762247 1:201105624-201105646 ATGAATATGCAGCTGATCAGAGG - Intronic
920125324 1:203689752-203689774 AAGAAGATGCATATGAATGAAGG + Intronic
920946215 1:210531269-210531291 ATGACTGTACATATGAACTATGG + Intronic
921271155 1:213471389-213471411 ATAAATAAGCATATTAATAATGG - Intergenic
921835178 1:219771352-219771374 TGGAATTAGCATATGAACAAGGG - Intronic
922995011 1:229949662-229949684 AAGGATAGACATATGAACAATGG + Intergenic
923232771 1:232004260-232004282 ATCAATATGAAGATTAACAAAGG + Intronic
923741814 1:236661647-236661669 GTAAATATGCATATGAAAAGAGG + Intergenic
1062869164 10:883972-883994 ATGCATATGCAAATGATGAAAGG + Intronic
1063927209 10:10992187-10992209 ATGAATCTACAGATCAACAATGG + Intergenic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1065890637 10:30118383-30118405 ATGAAAATGGATATGAATAAGGG - Intergenic
1066280801 10:33916487-33916509 ATGAAATTGTACATGAACAAAGG + Intergenic
1066579067 10:36860159-36860181 AAGACTATGCATATTTACAAAGG + Intergenic
1067922110 10:50469822-50469844 AGGAATGGGCATATGAACCAAGG + Intronic
1068818641 10:61347197-61347219 AAGAAAATGAATCTGAACAAAGG + Intergenic
1069361421 10:67646874-67646896 ATCATTATGCATATCATCAAAGG + Intronic
1069368805 10:67722120-67722142 CTGATTTTGTATATGAACAAGGG - Intergenic
1069372994 10:67766808-67766830 CTGTATATGCATATTAAAAATGG - Intergenic
1070466585 10:76730170-76730192 ATTAATATGCAAATGTATAATGG - Intergenic
1070938150 10:80317523-80317545 AGGAATATGCAATTCAACAATGG - Intergenic
1071522184 10:86338243-86338265 ATGGATAAGCACATGAACCAGGG + Intronic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1073572721 10:104594200-104594222 ATGAATGAGCAAATGAACATAGG - Intergenic
1074937444 10:118196319-118196341 ATGAATAAGCACATGAAAAAAGG - Intergenic
1076926047 10:133488420-133488442 ATGTGTGTGCATATGCACAATGG + Intergenic
1077939825 11:6829159-6829181 ATGAATATGCCAATGAAAGATGG - Intergenic
1080172001 11:29315696-29315718 ATGAATGTGCATCTGAATGAAGG - Intergenic
1080575421 11:33594500-33594522 ATGAGAAACCATATGAACAAAGG - Intronic
1081220825 11:40459138-40459160 GTGTATATGCATATGAAAGAGGG - Intronic
1082094114 11:48113233-48113255 ATGTATATACATATGCACACAGG - Intronic
1083701569 11:64482500-64482522 TTAAATATGCATATGAAAAAGGG - Intergenic
1084102906 11:66961609-66961631 GTTAATATGCATAAGAGCAATGG - Intergenic
1086856020 11:91867072-91867094 ATTTATATGCATATCAACATAGG - Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087897503 11:103603027-103603049 ATGGTTATGCATATTCACAATGG + Intergenic
1088089926 11:106025589-106025611 ATACATATACATATGCACAATGG - Intergenic
1089047233 11:115512758-115512780 ATGAAGATGCAAAAGAAAAATGG + Intergenic
1090730618 11:129570500-129570522 ATGAAGATGCAAAGGTACAAGGG - Intergenic
1091352757 11:134910645-134910667 ATAAATATGCATGTGAACACTGG + Intergenic
1091825939 12:3512789-3512811 ATGAATAAGTAAATGAACTATGG + Intronic
1091991065 12:4956204-4956226 AAAAATATGCAGAGGAACAATGG + Intergenic
1093444174 12:19235735-19235757 GTGAATAGGCATATGAAGAAAGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094195758 12:27748310-27748332 ATGAATAAGTAAATGAATAATGG + Intronic
1094749294 12:33386964-33386986 ATGAAAATGAATGTGGACAATGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096061756 12:48707170-48707192 AGAAAAATGGATATGAACAAAGG + Intronic
1097424440 12:59425213-59425235 ATGAATAACAATATGAACAATGG - Intergenic
1098058709 12:66537010-66537032 ATGAATATGCATATGGACTTTGG + Intronic
1098138213 12:67425403-67425425 CTTAATATGCATATGACCTATGG - Intergenic
1098625707 12:72663864-72663886 ATGCATATGTATATGTACATAGG + Exonic
1099336999 12:81375016-81375038 ATGAGTATACATTTTAACAAAGG + Intronic
1100108578 12:91208818-91208840 ATTAATATACATATGAAGGAAGG - Intergenic
1100337697 12:93647488-93647510 AAGGAAATGCATATGAAGAAAGG - Intergenic
1100669774 12:96799050-96799072 ATGGATATAGATATGAATAAAGG - Intronic
1100791940 12:98140093-98140115 CTAAATATGAATATGAATAACGG + Intergenic
1101240696 12:102835606-102835628 ATGTATGTGCATATGTACATAGG - Intergenic
1101693900 12:107106692-107106714 ATCAATATGCACATGGACATGGG + Intergenic
1101974156 12:109340798-109340820 TTGAACATGCATATGCAAAAAGG - Intergenic
1102264229 12:111468464-111468486 AGGAATTTGTATATGATCAAAGG - Intronic
1102585292 12:113918725-113918747 CTGAACATGCTTATAAACAATGG - Intronic
1103757747 12:123222992-123223014 ATGTATATGTATATAAAAAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104119871 12:125789022-125789044 ATGTATATGTATAAGAAAAAGGG + Intergenic
1105771445 13:23616252-23616274 ATGAATAGGCATGCTAACAAAGG + Intronic
1105821126 13:24081958-24081980 ATAGATATGCATATGACCTATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1109501550 13:63242407-63242429 ATGAATATGAATTTGTATAATGG + Intergenic
1110029633 13:70591084-70591106 AAAAACATGCATAAGAACAAAGG - Intergenic
1110150069 13:72240571-72240593 AAGAATCTGCATATGTAGAATGG + Intergenic
1110289843 13:73792018-73792040 ATGACTATGTATATAAACATAGG - Intronic
1111059820 13:83001593-83001615 ATACATATGCATATAAAGAAGGG - Intergenic
1111516372 13:89337059-89337081 ATTAAAATGCATGTCAACAATGG + Intergenic
1112144000 13:96677929-96677951 AAGAACATGCATATTAAAAATGG - Intronic
1112470922 13:99688082-99688104 ATGAAAATGCATATAATTAAGGG - Intronic
1112488460 13:99840784-99840806 TTACATATGCATATGAAAAAAGG + Intronic
1113033592 13:106023267-106023289 ATGAATATCTATATAAATAAAGG + Intergenic
1115124950 14:29981084-29981106 TTGAATGGGCCTATGAACAAAGG - Intronic
1116298105 14:43138422-43138444 ATGAATATTCATAATATCAAGGG - Intergenic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1120529383 14:85613874-85613896 ATGTATATGTATATTACCAAAGG + Intronic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124219719 15:27839203-27839225 GTGAAAAAGCATAAGAACAAAGG + Intronic
1124805497 15:32877855-32877877 ATGAATGAGCAAATGAACAATGG - Intronic
1125452599 15:39824686-39824708 ATGAAAAAGCAAATGAACATTGG + Intronic
1126944420 15:53803181-53803203 ATGAATATGTATATATACATGGG + Intergenic
1129745576 15:78017507-78017529 TTAAAAATGCTTATGAACAAAGG + Intronic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1130863867 15:87915174-87915196 GTGTATATGCATATGCATAATGG - Intronic
1131754343 15:95543873-95543895 AAGAATGTGCATTTTAACAAGGG - Intergenic
1135284712 16:21183379-21183401 ATTAACATGCACATGAACACAGG + Intergenic
1135842975 16:25893533-25893555 ATGAATTTGCATGTGACCCAAGG - Intronic
1135883344 16:26280522-26280544 ATGTGTATGCATAGGAACAGAGG - Intergenic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1137840927 16:51640296-51640318 ATGAATGTGCTTATGAAAAGAGG - Intergenic
1138845124 16:60555542-60555564 ATGAATATGATTATGAAACAGGG - Intergenic
1139289949 16:65848889-65848911 ATGAGTATAAATATGAAAAAAGG - Intergenic
1140991387 16:80215665-80215687 AGGTATATGCATAAAAACAAAGG - Intergenic
1141037254 16:80638759-80638781 ATGGATATCCATTTGAAAAAGGG + Intronic
1141134446 16:81456544-81456566 ATGAATGTACATCTGCACAAAGG - Intronic
1144012248 17:11160533-11160555 CTGCATATGCATAAGAACTATGG + Intergenic
1147314528 17:39613205-39613227 ATGAGAATGCATTTGACCAAAGG - Intergenic
1147492991 17:40888375-40888397 ATGACTTTGTGTATGAACAAGGG - Intergenic
1148946144 17:51262968-51262990 ATGAGTCTGCAGATGAAAAAAGG - Intronic
1149322748 17:55498123-55498145 ATATACATGCATATGAAGAATGG - Intergenic
1149751395 17:59148887-59148909 ACAAATAAGCATATGAAAAAAGG + Intronic
1149779203 17:59383008-59383030 AAAAATATGAAAATGAACAAGGG + Intronic
1151590497 17:75040974-75040996 ATGAATAAGCAAATGAACTCTGG + Intronic
1153196499 18:2604009-2604031 ATGAATATGAATGTAAATAAAGG + Intronic
1153711833 18:7808033-7808055 ATGAATATGCATAAGACGCAGGG - Intronic
1154086395 18:11309609-11309631 ATGGAGATGCATAGTAACAAAGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155634117 18:27931574-27931596 AAGAATATGAATATGTATAAAGG - Intergenic
1155721993 18:29027080-29027102 ATGTATATGCATATAAATATAGG + Intergenic
1155755134 18:29484136-29484158 ATATATATGTATATGCACAATGG + Intergenic
1155770577 18:29693240-29693262 ATGAATTAGCCTAGGAACAAAGG - Intergenic
1156975594 18:43218385-43218407 ATCAATATACATGTGAACAAAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159377766 18:67615746-67615768 ATTCACATGCATATGAACACAGG - Intergenic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159421804 18:68230775-68230797 ATAAAAATGCATAAAAACAAAGG + Intergenic
1159825959 18:73210702-73210724 ATGTCTATGCATAATAACAAGGG + Intronic
1160301584 18:77686527-77686549 GTAATTATGCATAGGAACAAAGG - Intergenic
1160570557 18:79814776-79814798 ATGTATATGTATATGCATAAAGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1164073319 19:21789351-21789373 ATGTATCCCCATATGAACAAAGG + Intergenic
925067379 2:938870-938892 ATGTACATGCATGTGAACACGGG - Intergenic
925363894 2:3297958-3297980 GTGAATGAGCAAATGAACAAAGG - Intronic
927344139 2:22017285-22017307 ATCAATGTGAATATAAACAAAGG + Intergenic
927620881 2:24656965-24656987 ACAAATATGCATATGTCCAAAGG - Intronic
927793262 2:26027408-26027430 CTGAATATGCATGGGAACAGTGG + Intergenic
930692530 2:54379417-54379439 AGGAATCTGCATATGAACTAGGG - Intronic
930904358 2:56548185-56548207 ATGAATATGGCTATGTACTAAGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933024051 2:77231989-77232011 TTGAAAATGTATCTGAACAAAGG - Intronic
933095750 2:78177953-78177975 ACAATTATGCATATGAACCAAGG + Intergenic
933115895 2:78470734-78470756 ATGAATATCCTTATGAGTAACGG + Intergenic
933117145 2:78488603-78488625 TTGAAAGTTCATATGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
934062903 2:88312646-88312668 ATAGATATGCATATGTACATTGG + Intergenic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
937379847 2:121366845-121366867 ATGAGTATGTATTTGTACAATGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938615240 2:132990930-132990952 ATGAATGAGCAAATGAACAGAGG + Intronic
939385427 2:141490275-141490297 ATTATTATGAATATAAACAATGG + Intronic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941913149 2:170786380-170786402 ATGAATAAAGATAAGAACAACGG - Intronic
942496203 2:176542223-176542245 ATGTGTATGCAAATGAACAAAGG - Intergenic
943429985 2:187787478-187787500 AATAATATGCATAGGAAAAATGG + Intergenic
943702540 2:191002315-191002337 ATGAATTTCCATATGCACACGGG + Intronic
943768301 2:191687309-191687331 ATGAATATGCATATGAACAAAGG - Intronic
944188014 2:196971035-196971057 TTGAATATGCCTATGGACAAGGG - Intronic
945165644 2:206940672-206940694 AATGATTTGCATATGAACAAGGG - Intronic
945558908 2:211313910-211313932 GTGAATAGCCATGTGAACAAAGG - Intergenic
945798562 2:214395449-214395471 GTGAATAAGCATATGAAAAGAGG - Intronic
945831135 2:214786739-214786761 AGGAGTATGTATATGAATAAGGG + Intronic
947099169 2:226600812-226600834 ATGAATGTGAATATGAAATATGG + Intergenic
947665319 2:231901656-231901678 ATGTTTGTGCATATGACCAATGG - Intergenic
947918831 2:233852500-233852522 AGGAGTATTCATATGAATAAAGG - Intronic
947994685 2:234517117-234517139 ATAAATATGCATGTGCACATAGG + Intergenic
948153076 2:235759767-235759789 TCGAAAATGCATATGAAGAAAGG - Intronic
1168862745 20:1057782-1057804 ATATATATATATATGAACAATGG - Intergenic
1170394707 20:15913909-15913931 ACGAATAAGCAAATGAACGATGG + Intronic
1171510560 20:25680507-25680529 ATGAATATTCATATTAAGAAAGG + Intronic
1171805763 20:29678734-29678756 ATGAATAAGCCTATTTACAAAGG - Intergenic
1172907879 20:38382719-38382741 ATGAATTGGCATATGAATACAGG - Intergenic
1174888676 20:54365158-54365180 ATGCATATGCTTATGAAAGATGG + Intergenic
1174992622 20:55528192-55528214 TTTAATATGCATATGCATAAAGG - Intergenic
1175296149 20:57910106-57910128 CTGAGTGTGAATATGAACAAAGG + Intergenic
1176152610 20:63599988-63600010 ATGAATTTGACTATGGACAATGG - Intronic
1177375699 21:20268494-20268516 ATGGATATGCATATGCACAAAGG + Intergenic
1177571103 21:22888288-22888310 ATTAACATGCATATGGACAAGGG + Intergenic
1177658710 21:24054337-24054359 ATGAATGTGCACATGCACAGAGG - Intergenic
1178909602 21:36663988-36664010 ATGAATATGAATATGAAAGGCGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1183591953 22:38784370-38784392 ATGAGGAGGCGTATGAACAAGGG - Intronic
949121203 3:386559-386581 ATACATATGCTTAAGAACAATGG - Intronic
950562629 3:13743730-13743752 ATGACTAGGCATATACACAAAGG - Intergenic
950685459 3:14615192-14615214 ATTAAAATGCATGAGAACAATGG + Intergenic
951074640 3:18375095-18375117 ATGAATATGTCAATGAAGAAAGG + Intronic
951150629 3:19286048-19286070 ATGACTTTTCTTATGAACAAAGG - Intronic
952136259 3:30424917-30424939 ATGAATATCCATAAGATGAATGG - Intergenic
953534699 3:43768874-43768896 ATGAATTTGGATATGGAGAATGG + Intergenic
955426734 3:58799086-58799108 ATGTGTATGCATATAAATAATGG + Intronic
955786140 3:62541011-62541033 ATGAAAATGAATTTGAACATCGG + Intronic
955875289 3:63482805-63482827 ATGAATATGTACATGGATAATGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
955964675 3:64376630-64376652 ATGAGTAAGTATATGAAAAAAGG + Intronic
957239966 3:77646645-77646667 AGGAAGATGCAAAGGAACAATGG + Exonic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
958916262 3:100053875-100053897 AGGAAGCTGCATATGAATAATGG - Intronic
959035167 3:101354150-101354172 AAATATATGCATGTGAACAAAGG - Intronic
959399363 3:105880617-105880639 ATGGATAAGCTTATGAAGAATGG + Intergenic
959469195 3:106728353-106728375 ATGAACAAGGATATGAAGAATGG - Intergenic
959557255 3:107735256-107735278 ATGCATAGGCAGATGAACATGGG + Intronic
959717939 3:109453876-109453898 ATTAATATGCATACTAAAAATGG + Intergenic
960434634 3:117610645-117610667 ATTAACATGCATATTAACATAGG + Intergenic
960900102 3:122545677-122545699 AAGAATAAGCATAGGAAAAATGG + Intronic
960943499 3:122950134-122950156 AAGAATATACATACAAACAAGGG + Intronic
960984867 3:123270910-123270932 TTTAATATTTATATGAACAAGGG + Intronic
961096958 3:124165736-124165758 ATGAATATAAATATATACAATGG - Intronic
961119088 3:124357983-124358005 ATGAATATTTATAAGAACACAGG + Intronic
961195959 3:125001691-125001713 AAGAAGATGCATGTGCACAAAGG + Intronic
961505059 3:127365057-127365079 ATGTATATGGATTTTAACAAGGG + Intergenic
961672527 3:128544283-128544305 ATGAATATGCATATTATATATGG - Intergenic
961672528 3:128544330-128544352 ATGAATATGCATATTATATATGG - Intergenic
961672531 3:128544452-128544474 ATGAATATGCATATTATATATGG - Intergenic
961672533 3:128544508-128544530 ATGAATATGCATATTATATATGG - Intergenic
961672534 3:128544536-128544558 ATGAATATGCATATTATATATGG - Intergenic
961672536 3:128544592-128544614 ATGAATATGCATATTATATATGG - Intergenic
961672537 3:128544620-128544642 ATGAATATGCATATTATATATGG - Intergenic
961672539 3:128544695-128544717 ATGAATATGCATATTATATATGG - Intergenic
961672542 3:128544798-128544820 ATGAATATGCATATTATGTATGG - Intergenic
962113703 3:132478296-132478318 ATGAATAGGAAAATGAATAATGG + Intronic
963821643 3:149902141-149902163 ATGAATTCACATATGAAAAAGGG + Exonic
964323385 3:155521082-155521104 GGGAAGATGCATTTGAACAAAGG - Intronic
964426490 3:156559744-156559766 ATGAATATCCTTAGGCACAAAGG - Intergenic
964913470 3:161810895-161810917 GTAAATATGCATATAAATAATGG + Intergenic
965290914 3:166878975-166878997 ATGAATCAGTTTATGAACAAAGG + Intergenic
965501753 3:169464781-169464803 ATGATTATGACCATGAACAATGG - Intronic
966510384 3:180755798-180755820 ATTATTATGCATATGAAGCATGG + Intronic
967135781 3:186511597-186511619 ATGAAGATGCGTGTGAACCATGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968162133 3:196435256-196435278 AAGAATATGAATATGAAGGATGG + Intergenic
968231049 3:197004704-197004726 ATGAATACGAATATAAATAAAGG + Intronic
968774240 4:2530166-2530188 ATGAATATGCAAAACAACATTGG + Intronic
970065519 4:12089499-12089521 ATTAATATGCAAATGGAAAAGGG - Intergenic
970148442 4:13063303-13063325 AATAATATGCTTCTGAACAATGG - Intergenic
970765174 4:19539524-19539546 ACGAATAAGAAAATGAACAAAGG - Intergenic
971111427 4:23590434-23590456 AAGAATATGCTATTGAACAATGG - Intergenic
971305248 4:25474193-25474215 ATGAATATGGCCATGAGCAATGG - Intergenic
971715373 4:30168642-30168664 ATGAATAAGATAATGAACAAGGG + Intergenic
972060345 4:34862191-34862213 ATAAATGTGTATATAAACAATGG + Intergenic
972087579 4:35239454-35239476 TTGAGGATGCATCTGAACAATGG - Intergenic
973206540 4:47566812-47566834 ATTAATATGCATATTAAATAAGG - Intronic
974101101 4:57418042-57418064 TTGAATTTGCATAGGAAAAAAGG + Intergenic
974201227 4:58643370-58643392 CTGAATTTGCCTATGAACAATGG + Intergenic
974393789 4:61308717-61308739 ATTAAAATGCATATGTAAAATGG + Intronic
974631103 4:64490117-64490139 ATGAATATGAAGAGGGACAATGG - Intergenic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976868694 4:89763856-89763878 TTGAATAAGAATATGTACAAGGG - Intronic
977695747 4:99963246-99963268 ATAAATATGTATATAAACATTGG + Intergenic
977714813 4:100170355-100170377 ATGAATCTGTAAATAAACAAAGG - Intergenic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
978506635 4:109464618-109464640 ATGAAAATGCATGTAAAAAATGG + Intronic
979009471 4:115349235-115349257 ATAAACATGCAGATGAAAAAGGG + Intergenic
979745184 4:124204640-124204662 ATGAATATACATATGAAATCAGG - Intergenic
980743446 4:136982162-136982184 ATTAATATGTATCTGATCAAAGG - Intergenic
981705285 4:147652896-147652918 AAGAATATAAATATGAAAAAAGG + Intronic
981797873 4:148618384-148618406 ATTAATTGGCATATGAACAGTGG - Intergenic
982906378 4:161079718-161079740 ATTAATATGTACATGTACAAAGG + Intergenic
982963966 4:161878326-161878348 ATGAATATGCATATGTATTATGG + Intronic
983045406 4:162980898-162980920 ATGAATATGTAAATCACCAATGG - Intergenic
983322916 4:166216386-166216408 AGGTATGTGCATTTGAACAATGG + Intergenic
983391760 4:167140917-167140939 ATCAATGTGCACATGAACATGGG - Intronic
984094612 4:175419052-175419074 ATGAAAATGAATGTTAACAATGG - Intergenic
985282635 4:188302119-188302141 AGGAATCTGCATTTGAAGAAGGG + Intergenic
985960600 5:3300500-3300522 ATAAATATGAAGATGAACATCGG - Intergenic
986133653 5:4954209-4954231 ATGAAAATGTATATTACCAAGGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
988932606 5:36051420-36051442 ATGAATATATATAAGAAGAAGGG + Intronic
989283399 5:39670584-39670606 ATTTATTTGCATATGAATAAAGG - Intergenic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
991171904 5:63637238-63637260 ATGAATATGGAAATGCACACTGG - Intergenic
992279489 5:75159770-75159792 ATGAAAAAGCCTATGAATAATGG + Intronic
992471452 5:77059775-77059797 ATGAATGTTATTATGAACAAAGG - Intronic
993159269 5:84267661-84267683 TTCAATATGTATCTGAACAAGGG + Intronic
993694879 5:91049678-91049700 ATGAATTTTCATAAGAAAAATGG + Intronic
993835329 5:92812815-92812837 ATGAATTAGAATATGAACAATGG - Intergenic
993907666 5:93641459-93641481 ATAAATCTGCACATGAAAAAAGG + Intronic
993998794 5:94753751-94753773 ATGAACATGCATATGCAGAAGGG + Intronic
994301124 5:98148670-98148692 ATAGATATGCATATGTACACTGG - Intergenic
994639749 5:102392495-102392517 ATGATTATACTTATGAATAATGG - Intronic
994780866 5:104088417-104088439 TTGAATCTGCAGATGAAGAATGG - Intergenic
995011681 5:107262765-107262787 ATGAATTAGTGTATGAACAATGG - Intergenic
995278149 5:110301541-110301563 ATGAACAGGCATATGAAAAAGGG - Intronic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
995719636 5:115117212-115117234 AAGAGTATGAATGTGAACAAAGG + Intergenic
995789615 5:115871345-115871367 AGAATTATACATATGAACAATGG - Intronic
995988940 5:118212232-118212254 ATCAATGGTCATATGAACAAAGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
997074354 5:130654544-130654566 ATGCTTATGCACATCAACAAGGG + Intergenic
997086027 5:130800395-130800417 ATAAATATGCAAATCAACATTGG + Intergenic
997866613 5:137469463-137469485 ATTAATATTCATAAGAACCATGG - Intronic
999840900 5:155425441-155425463 ATTACTATGCATATGTACACAGG - Intergenic
999962602 5:156772941-156772963 ATCAATACATATATGAACAAAGG + Intergenic
1000528789 5:162392401-162392423 ATGAATGAGTACATGAACAAAGG - Intergenic
1000934850 5:167295063-167295085 ATGAATAGGGAAATAAACAAAGG + Intronic
1000968446 5:167687327-167687349 TAAAATATGCATATGCACAAAGG + Intronic
1001198856 5:169697937-169697959 ATGAGTATGCTTATGAAAAGAGG + Intronic
1001583817 5:172819301-172819323 ATGATTCTAAATATGAACAATGG + Intergenic
1003199191 6:3943259-3943281 ATGAATATGCACAGTAAAAATGG + Intergenic
1003570712 6:7254677-7254699 CAGAATTTGCATGTGAACAAGGG + Intergenic
1004091420 6:12506296-12506318 GTGAATATGCATAGCGACAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004786308 6:18971693-18971715 ATAAATATACATAAAAACAAAGG - Intergenic
1005160741 6:22859753-22859775 ATGTATATGCATGGGAACAATGG - Intergenic
1005583901 6:27257946-27257968 ATGACTGTGCATATGCACAAGGG + Intergenic
1005701645 6:28407148-28407170 AAGAATATGAGTATGAATAAAGG + Intergenic
1006682690 6:35808593-35808615 ATATATATATATATGAACAAAGG + Intronic
1007150062 6:39681376-39681398 ATGAAAATATACATGAACAAGGG - Intronic
1008393521 6:50980497-50980519 AAGGATATGCTTATGAACATGGG - Intergenic
1009283747 6:61785539-61785561 GTGTATATGCATATGAAAATTGG + Intronic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1010435325 6:75822974-75822996 ATGAATATTCATGTGAATGAAGG + Intronic
1011355594 6:86469891-86469913 TTTAATATGCATATGAACATGGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012494060 6:99814715-99814737 AGGGAAATGCATATGATCAAAGG - Intergenic
1012895102 6:104938703-104938725 ATGAAAAGCCATAAGAACAAAGG - Intergenic
1013456870 6:110337545-110337567 AAGAATCTGCATAAGACCAATGG - Intronic
1013733696 6:113201770-113201792 ATGTATATGTATATAAACAGGGG - Intergenic
1014024528 6:116630106-116630128 ATTAATATGAATAAGATCAAGGG - Intronic
1014593453 6:123302398-123302420 CTGAATATGCAAAGGATCAATGG - Intronic
1015314915 6:131807525-131807547 ATGGAAATGCAAATGAACCATGG - Intergenic
1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG + Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016894850 6:149041631-149041653 ATGAAGAGGCATCTGAACAGCGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017375616 6:153764306-153764328 AAGAAAATGCATATACACAATGG + Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020875326 7:13686165-13686187 ATGACTATACATGTAAACAAAGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021363079 7:19741186-19741208 ATGAATCTCCATATAAACAATGG + Intronic
1021418515 7:20418090-20418112 GTGAGTATGCACATGAAGAAAGG + Intergenic
1022769011 7:33449076-33449098 ATAAATATTGAGATGAACAAGGG + Intronic
1023219425 7:37903638-37903660 ATGAAAACACATATGATCAAGGG + Intronic
1024081164 7:45856457-45856479 ATGTATATGCATATATACACAGG - Intergenic
1024535635 7:50429210-50429232 ATCACTGTGCATATGAACACAGG + Intergenic
1024832192 7:53473758-53473780 ATGAATGTGCTTATCAACCAGGG - Intergenic
1025016989 7:55447619-55447641 ATGCATATGTATATGAAATATGG - Intronic
1025286012 7:57661772-57661794 ATGTATATGTATATGGAAAAGGG - Intergenic
1026527233 7:71164947-71164969 ATGAATTTGCATAAGAAGCAAGG + Intronic
1027835097 7:83231621-83231643 AAGAATATGCCTCTCAACAAGGG + Intergenic
1028021374 7:85779031-85779053 ATAAATATGCATATGGAAATAGG + Intergenic
1028122740 7:87074496-87074518 ATGAATATGTACAAGAAAAATGG - Intergenic
1028281285 7:88932235-88932257 ATGAGTATTCTTATGTACAATGG - Intronic
1028281584 7:88936402-88936424 ATTAAGATGCATATAAACATGGG + Intronic
1028758992 7:94473638-94473660 ATGAATATTCATATGTAGGATGG - Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029894097 7:103963382-103963404 ATGTATAAGCAGATAAACAAAGG + Intronic
1029909222 7:104126461-104126483 AAGAATGGGCATATAAACAAGGG + Exonic
1029913832 7:104185076-104185098 ATTAATATGCATATGGGCACAGG - Intronic
1030836199 7:114289808-114289830 ATGAATATGCATAATGCCAAAGG + Intronic
1030881326 7:114883393-114883415 AGGAATATGGAGATGAACAAAGG - Intergenic
1032750889 7:134840247-134840269 ATGAATATCTATATGGAAAAAGG - Intronic
1032832551 7:135642540-135642562 ATGAAGATGCAAAGGAACAGTGG - Intronic
1032943411 7:136822512-136822534 ATGAAGATGAATAATAACAAAGG - Intergenic
1032981842 7:137293019-137293041 ATGAATATGCATGTGGGTAAAGG - Intronic
1033862811 7:145649516-145649538 ATTAATATGCAAAATAACAATGG - Intergenic
1033915939 7:146325647-146325669 ATGAATATGGAGGTGAACATAGG + Intronic
1034172637 7:149074414-149074436 ATCAAAATGCATATCAACAGAGG + Exonic
1034693872 7:153036949-153036971 ACAAATAAGCATATGGACAAAGG - Intergenic
1035540399 8:431385-431407 ATGAATATGCATCGAAAAAAAGG + Exonic
1035936873 8:3851231-3851253 ATGAATTTGCATCTAGACAAGGG + Intronic
1036199802 8:6760097-6760119 AAGAATATAATTATGAACAAAGG - Intergenic
1036727101 8:11230167-11230189 ATGAATAAACAAATGAACACAGG + Intergenic
1037533163 8:19799050-19799072 ATTATTAAGGATATGAACAATGG - Intergenic
1037800484 8:22032295-22032317 ATGGATATACATAAGAATAAAGG - Intronic
1038260525 8:25989508-25989530 ATAAATATCCATGTAAACAAGGG + Intronic
1038389938 8:27187462-27187484 ATAAATAAGCATATAAATAAGGG - Intergenic
1039154002 8:34535105-34535127 ATGAATATGCTGATGAGCACAGG - Intergenic
1039174566 8:34788678-34788700 ATATATATACATATGTACAATGG - Intergenic
1039199222 8:35069716-35069738 ATGCAGCTGCATTTGAACAACGG - Intergenic
1039730559 8:40271740-40271762 TTGAATATCCATATCCACAATGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1039783384 8:40810586-40810608 AAAAATATGAATATGAAAAATGG + Intronic
1040049395 8:42997287-42997309 ATTAATATGCATAAGTACATTGG + Intronic
1040605233 8:48924775-48924797 ATGAATATGCATATGAATTGAGG - Intergenic
1041626171 8:60029840-60029862 TTGAATATGCATATTTAAAACGG - Intergenic
1042387454 8:68193900-68193922 ATGAATGTGCTTATGAAAAATGG + Intronic
1042483313 8:69326845-69326867 ATGGATATGCTTGTGATCAAAGG - Intergenic
1043095027 8:75956978-75957000 ATAAAGATGCATATGTACACAGG + Intergenic
1043096096 8:75975249-75975271 ATGAAGATGCATATTTACACAGG - Intergenic
1043287544 8:78552613-78552635 AGGAACATGCATGGGAACAATGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044291316 8:90473951-90473973 CTGACTTTGAATATGAACAAGGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1046173789 8:110547816-110547838 TTTAACAGGCATATGAACAATGG + Intergenic
1046434688 8:114172114-114172136 ATAAATATCTATATTAACAAAGG + Intergenic
1046634259 8:116655409-116655431 AAGAGTCTGCATCTGAACAAGGG + Intronic
1047351654 8:124080110-124080132 ATGAATGACCAAATGAACAATGG + Intronic
1047988844 8:130264709-130264731 ATGAATATGAACATGAGAAAGGG + Intronic
1048266526 8:132992099-132992121 ATGAATAAGCAACTGAACAAAGG - Intronic
1050629146 9:7540440-7540462 ATGAATATGCTTCTCAAAAAAGG - Intergenic
1051254397 9:15198033-15198055 TTGAATAAGAATATGAAAAATGG + Intronic
1052366978 9:27623149-27623171 ATGAATAAGCACATAAAAAAAGG - Intergenic
1052784382 9:32815033-32815055 ATTAATATGCACATGGACACAGG - Intergenic
1053091607 9:35283240-35283262 AGGAAAATACCTATGAACAATGG - Intronic
1053530444 9:38876045-38876067 ATGAATATCCCTGTTAACAAAGG - Intergenic
1053722094 9:40956844-40956866 ATGAAGATGCAGATGACAAATGG + Intergenic
1054202669 9:62100475-62100497 ATGAATATCCCTGTTAACAAAGG - Intergenic
1054725224 9:68643195-68643217 CTATATATGCATATTAACAATGG - Intergenic
1055181649 9:73395222-73395244 ATGAAAATGCATTTGAAGCAAGG - Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056108159 9:83368244-83368266 ATGAAAATCTATATGAGCAAAGG + Intronic
1058643920 9:107112817-107112839 ATGAATGTACGTATGAAAAAGGG + Intergenic
1058991470 9:110257859-110257881 ATGAATATGGATATAGGCAAGGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059180411 9:112206946-112206968 ATGCATATGCATATGACTACAGG + Intergenic
1060710187 9:125854695-125854717 ATGAATATGACTATGAAAATGGG - Intronic
1061715335 9:132515114-132515136 AGGAATCTGCATTTTAACAAGGG - Intronic
1062195991 9:135274443-135274465 ATATACATGCCTATGAACAAAGG + Intergenic
1187761215 X:22587887-22587909 ATGAATGTGCAAATGTATAAGGG - Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188317902 X:28698108-28698130 ATGAATATGAATATGTAAATTGG + Intronic
1188402729 X:29767102-29767124 AAGAATATAAATATCAACAAAGG - Intronic
1188709948 X:33383805-33383827 ATGAATATGCACAGGAAGAAAGG - Intergenic
1188922936 X:36001355-36001377 ATGAATATAAATAGGAATAAAGG - Intergenic
1189115822 X:38341596-38341618 ATGAAGATGCATAATAAAAATGG - Intronic
1190281051 X:48930380-48930402 GGGAATTTGCAGATGAACAAGGG + Intronic
1190420542 X:50279333-50279355 ATGAATATATATATGAATATAGG + Intronic
1190500115 X:51067214-51067236 ATGTATATGCATGGGAAAAAAGG + Intergenic
1192339879 X:70255174-70255196 ATCAATAGTCAGATGAACAAAGG + Intergenic
1192355599 X:70400534-70400556 ATGAATATGCAGATGGGAAAAGG - Intronic
1192868055 X:75156694-75156716 AAGAATATGCATAGGGAAAATGG - Intronic
1193710890 X:84878363-84878385 CTTAATATGCCAATGAACAATGG - Intergenic
1194144437 X:90245256-90245278 ATAAATATGCATAAGTAAAAAGG - Intergenic
1194690378 X:96977126-96977148 ATGATTAACCATATGAAAAAGGG - Intronic
1194988696 X:100520926-100520948 ATGAACATGAACATGAACATGGG - Intergenic
1195422906 X:104695477-104695499 ATGAATGTGCATATGACTAAGGG + Intronic
1195423981 X:104706864-104706886 ATGAATCTGCATACAAGCAAAGG - Intronic
1196188925 X:112774510-112774532 ATGAATTGGCATCAGAACAAGGG + Exonic
1196256346 X:113523645-113523667 ATGAACATGCATGGGAAAAAAGG - Intergenic
1197083160 X:122441891-122441913 AAGAAGATGCAAGTGAACAATGG - Intergenic
1197221029 X:123914183-123914205 ATGTATATATATATGAACAATGG + Intergenic
1198425209 X:136511688-136511710 AAGAATATGCAGATGAAAAGGGG + Exonic
1198789613 X:140329787-140329809 ATGAATAGGCAGATGATAAATGG - Intergenic
1200425389 Y:3014742-3014764 ATGAATAAGCAAATGAACAGAGG - Intergenic
1200490196 Y:3814560-3814582 ATAAATATGCATACGTAAAAAGG - Intergenic
1202135453 Y:21656242-21656264 ATCAGTATGATTATGAACAAAGG - Intergenic