ID: 943769558

View in Genome Browser
Species Human (GRCh38)
Location 2:191701796-191701818
Sequence CTCACTCATTTCCACAAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943769558_943769561 9 Left 943769558 2:191701796-191701818 CCGTCCTTGTGGAAATGAGTGAG No data
Right 943769561 2:191701828-191701850 TGTTGGTTTCTGTGAGCATCTGG No data
943769558_943769560 -8 Left 943769558 2:191701796-191701818 CCGTCCTTGTGGAAATGAGTGAG No data
Right 943769560 2:191701811-191701833 TGAGTGAGTTCTTGTTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943769558 Original CRISPR CTCACTCATTTCCACAAGGA CGG (reversed) Intergenic
No off target data available for this crispr