ID: 943780441

View in Genome Browser
Species Human (GRCh38)
Location 2:191817528-191817550
Sequence CCACTCATTAAATGAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943780441_943780445 24 Left 943780441 2:191817528-191817550 CCACTTTTTCATTTAATGAGTGG No data
Right 943780445 2:191817575-191817597 ATAAGCTCTTTCCCGGTGCCAGG No data
943780441_943780444 17 Left 943780441 2:191817528-191817550 CCACTTTTTCATTTAATGAGTGG No data
Right 943780444 2:191817568-191817590 CATTTATATAAGCTCTTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943780441 Original CRISPR CCACTCATTAAATGAAAAAG TGG (reversed) Intergenic
No off target data available for this crispr