ID: 943782040

View in Genome Browser
Species Human (GRCh38)
Location 2:191835940-191835962
Sequence CGTGCAGCCCGCCGTGCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943782040_943782048 8 Left 943782040 2:191835940-191835962 CCTGGAGCACGGCGGGCTGCACG 0: 1
1: 0
2: 2
3: 13
4: 144
Right 943782048 2:191835971-191835993 ATCGGAGCGCTCCGCCTCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 68
943782040_943782044 -10 Left 943782040 2:191835940-191835962 CCTGGAGCACGGCGGGCTGCACG 0: 1
1: 0
2: 2
3: 13
4: 144
Right 943782044 2:191835953-191835975 GGGCTGCACGGGGTCCCCATCGG 0: 1
1: 0
2: 0
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943782040 Original CRISPR CGTGCAGCCCGCCGTGCTCC AGG (reversed) Exonic
900109830 1:1000676-1000698 TCTGCAGCCCTCCGTGCTCCAGG - Intergenic
900357975 1:2273848-2273870 CGTGCAGGCAGACGTGCTCTTGG + Intronic
900783623 1:4633842-4633864 CGTGGACCCCGCCCTGCTCCTGG - Intergenic
900945689 1:5830329-5830351 CGTGCAGCCAGCAGAGCACCTGG + Intergenic
902286187 1:15410043-15410065 CGTTCAGCCCGGGCTGCTCCGGG - Exonic
906525412 1:46490585-46490607 CGCGAACCCCGCAGTGCTCCGGG + Intergenic
909318011 1:74248014-74248036 CCTGCAGCCCGCCATGCCCAAGG - Intronic
917790235 1:178494721-178494743 AGTGCAGCCGGCAGTGCTGCTGG + Intergenic
919518018 1:198550981-198551003 TGTGCAGCCCCCCCTGCTCCAGG - Intergenic
920101973 1:203522399-203522421 CGTGCCTCCTGCCGGGCTCCAGG - Intergenic
922581116 1:226698715-226698737 GGGGCAGCCCTCCCTGCTCCAGG + Intronic
923141404 1:231163470-231163492 CGCGCAGGCCGCGGTGGTCCAGG - Exonic
1067219996 10:44337115-44337137 CCAGCAGCCCGTCGTCCTCCAGG - Intergenic
1069569810 10:69487503-69487525 TGTGCAGCCAGCAGAGCTCCCGG + Intronic
1070307084 10:75246038-75246060 GGTGCAGCCTGCCCTGCTCGGGG + Intergenic
1072187968 10:93060462-93060484 CTTGCGCCCCGCAGTGCTCCTGG - Intergenic
1077043906 11:535993-536015 CGAGCATCCCGCCTTGGTCCCGG - Intronic
1077199824 11:1300803-1300825 CGTGTGGCCAGCCGTGCTTCAGG - Intronic
1077315510 11:1917794-1917816 GGTGCTGCCCGCCCAGCTCCTGG - Intergenic
1077325951 11:1964204-1964226 CGAGGACACCGCCGTGCTCCCGG + Intronic
1080668601 11:34357091-34357113 GGTGCAGAGCGCCGTGCGCCTGG - Exonic
1081938099 11:46918473-46918495 CGCGCAGGCCGCCGTGCACCCGG - Exonic
1084070102 11:66728266-66728288 CCCGCCGCCCGCCGTGCGCCCGG - Intronic
1084410480 11:69003612-69003634 CGGGCAGCACTCCGAGCTCCAGG - Intergenic
1085240659 11:75051205-75051227 CATGCAGCCCGCAGTGCTAAAGG + Intergenic
1087382632 11:97426120-97426142 AGTGCAGCCAGCCATGATCCAGG - Intergenic
1088606826 11:111540870-111540892 CGTGCTGCTGGCCGTGCTGCTGG + Exonic
1091108200 11:132942759-132942781 CGTGCCGACTGCCGTGCCCCTGG - Intronic
1202808931 11_KI270721v1_random:19383-19405 CGAGGACACCGCCGTGCTCCCGG + Intergenic
1092232856 12:6786596-6786618 GGAGCAGCACGCCGTCCTCCAGG - Intergenic
1094125051 12:27014510-27014532 CGCGCAGCCTGCGGTGCTCCCGG + Intergenic
1103702967 12:122857176-122857198 CCTGCAACTCGCCCTGCTCCTGG - Exonic
1104558962 12:129826500-129826522 AGTGCAGCCCGCCTTGCTCCTGG + Intronic
1104727736 12:131088133-131088155 CGTGCAGTCCGCCCATCTCCAGG - Intronic
1105250917 13:18697981-18698003 CCTGCAGGCCTCAGTGCTCCTGG - Intergenic
1108417084 13:50208935-50208957 CCTGCAGCCCGCCAGACTCCAGG + Intronic
1113991440 14:16030551-16030573 CCAGCAGGCCGCCGTGCTGCGGG + Intergenic
1114265079 14:21069183-21069205 CGTGCCTCCCCCCGGGCTCCTGG + Intronic
1116932608 14:50704819-50704841 GGTGCAGCCAGCTATGCTCCAGG + Intergenic
1117545832 14:56794463-56794485 CGTTCTTCCCGCCGCGCTCCGGG - Intergenic
1118915435 14:70098941-70098963 CTTGCAGCCCACGGTTCTCCGGG + Intronic
1121300606 14:92867755-92867777 CGTGCAGCCTGCTGTGCCCAGGG - Intergenic
1122644463 14:103184320-103184342 CGTGGAACCCGCCCTGCTCTCGG + Intergenic
1122884999 14:104707020-104707042 CGTGAACCGGGCCGTGCTCCTGG + Exonic
1124007577 15:25807212-25807234 CGAGCAGCCAGTGGTGCTCCAGG - Intronic
1124118057 15:26866509-26866531 CCTGCAGCCCCCAGGGCTCCTGG + Exonic
1124971766 15:34495870-34495892 CGTGCACCCCGCCTCGCTCTGGG + Intergenic
1125882722 15:43208188-43208210 TGTGCAGCCCTGCGTGGTCCTGG + Intronic
1126935345 15:53700896-53700918 CAGGCAGCCCAACGTGCTCCAGG + Intronic
1127798204 15:62455945-62455967 AGTGCAGCCAGCCCTGCTCCTGG + Intronic
1128611074 15:69074170-69074192 CCTGCACCCAGCCCTGCTCCGGG - Intergenic
1131353590 15:91723911-91723933 CCTGCTGCCCTCCGAGCTCCAGG - Intergenic
1132527775 16:426060-426082 CGTCCGGCCCGCCCGGCTCCGGG - Exonic
1132748751 16:1447699-1447721 CTTGCAGCCTGCCCGGCTCCAGG - Exonic
1136910630 16:34141675-34141697 CCAGCAGGCCGCCGTGCTGCGGG + Intergenic
1139606527 16:68022785-68022807 CGTGCAGCACACGGGGCTCCAGG + Exonic
1140477232 16:75245120-75245142 CCTGCAGCCCACCGGGCTCAGGG + Intronic
1141132297 16:81444771-81444793 CGGGCCGCGCGCCGGGCTCCCGG - Intergenic
1141599030 16:85114146-85114168 CTGGCAGCTCTCCGTGCTCCTGG - Intergenic
1142156410 16:88534580-88534602 CGAGCAGCAGGCCGTGCGCCAGG - Exonic
1142223096 16:88864885-88864907 CGTGCAGGCCGCCGTGGAGCTGG - Exonic
1144208720 17:12997152-12997174 CCTGCAGCCCGCCCTGCACCAGG - Intronic
1144392745 17:14811109-14811131 GATGCAGCCTGCCATGCTCCAGG - Intergenic
1145050277 17:19654422-19654444 CCTGCAGCCCGCCATGCCCAAGG - Intronic
1148067144 17:44879978-44880000 CGAGCAGCACACTGTGCTCCAGG - Intronic
1151911432 17:77086097-77086119 CCTGCAGCCCTCCCAGCTCCGGG + Intergenic
1152925365 17:83085202-83085224 CGAACAGGCCGCCCTGCTCCAGG - Exonic
1154437928 18:14360933-14360955 CCTGCAGGCCTCAGTGCTCCTGG + Intergenic
1160527859 18:79547889-79547911 CGTCCTGCCAGCCGTGCTGCGGG + Intergenic
1160921289 19:1521995-1522017 CATGCAGTCCGCGGTGATCCTGG + Intergenic
1161061608 19:2217846-2217868 CGTGCAGCCCAACAAGCTCCCGG + Exonic
1161869182 19:6857234-6857256 CGTCCAGCTGGCGGTGCTCCCGG + Intronic
1162954355 19:14090168-14090190 CCAGCAGCGCGCCGTGCTCCGGG - Exonic
1163364657 19:16869254-16869276 TGTGCAGCCCCATGTGCTCCTGG - Intronic
1164833455 19:31340708-31340730 CCTGCAGCCCCCAGTCCTCCCGG - Intronic
1167471277 19:49677624-49677646 CGTGGAGCCCGCCGGGCCACTGG - Intronic
1168011558 19:53537635-53537657 CATGCAGCACGGCGTACTCCTGG - Intronic
1168398208 19:56066634-56066656 GGAGGAGCCCGCCCTGCTCCCGG - Intergenic
1168722658 19:58562773-58562795 CGCGCGGCGCGCCGTGCTGCTGG - Exonic
927965017 2:27262976-27262998 CGAGCAGCCCGCCGACCCCCGGG + Exonic
929242454 2:39666253-39666275 CGTCCAGCCCGCCGAGCCCCAGG - Exonic
931467776 2:62506235-62506257 CGGGCAGCCCCGCGCGCTCCCGG - Exonic
932615530 2:73228907-73228929 CCGCCCGCCCGCCGTGCTCCTGG + Exonic
934501269 2:94861910-94861932 AGAGCAGCCAGCCGTGCTGCTGG - Intergenic
934571921 2:95377959-95377981 CGTGGAGCACACCGTTCTCCTGG - Intronic
937135073 2:119544869-119544891 CGTGGAGACCGCCTGGCTCCTGG + Intronic
943782040 2:191835940-191835962 CGTGCAGCCCGCCGTGCTCCAGG - Exonic
946322012 2:218959865-218959887 CGGGCAGCCCGCCGGGCCTCCGG - Exonic
947550441 2:231041667-231041689 CATGCACCCCACCATGCTCCTGG - Intronic
947710443 2:232310810-232310832 CTTGCTGCCCTCCCTGCTCCTGG - Intronic
1174645882 20:52085027-52085049 GGTGCAGCCGGCTGTGCTCCAGG + Intronic
1175191096 20:57212705-57212727 ACTGCAACCCGCCGTGCACCTGG + Intronic
1175761178 20:61562961-61562983 CCTGGACCCAGCCGTGCTCCTGG - Intronic
1176300452 21:5096631-5096653 CGTGAAGCCCTCGCTGCTCCAGG + Intergenic
1176870701 21:14081249-14081271 CGAGCATGCCGCTGTGCTCCAGG + Intergenic
1179809371 21:43860723-43860745 CGTCCAGCCCTACCTGCTCCAGG + Intergenic
1179856591 21:44165350-44165372 CGTGAAGCCCTCGCTGCTCCAGG - Intergenic
1179996619 21:44977281-44977303 CCTGCAGGCCTCAGTGCTCCTGG - Intergenic
1180315828 22:11276973-11276995 CCAGCAGGCCGCCGTGCTGCGGG - Intergenic
1181037536 22:20177146-20177168 CATGCAGCCCCCCAGGCTCCAGG - Intergenic
1183506953 22:38214686-38214708 CGCGCAGCGCGTCGAGCTCCAGG - Exonic
949559495 3:5188377-5188399 GGTGCAGCCCTCTGTCCTCCGGG + Intronic
953404621 3:42654332-42654354 CGTGCAGCCCGCCCTGCCGCAGG - Intronic
961035312 3:123637893-123637915 CTGGCAGCCCACCCTGCTCCTGG - Intronic
967042740 3:185708578-185708600 GCTGCACCCCGCCGTGCGCCAGG - Intronic
973888470 4:55346438-55346460 CCTGCCGCCCGGCCTGCTCCCGG + Exonic
976758430 4:88523335-88523357 CGTCCTGCCCGCTGTGCGCCCGG + Intronic
979455511 4:120922416-120922438 GGTGAAGCCCGCCGCGCCCCGGG + Intronic
985128955 4:186723355-186723377 GGCGCAGCCCGGCGAGCTCCCGG + Intronic
997072007 5:130633388-130633410 GGTGAAGCCCGCTGGGCTCCTGG + Intergenic
998041030 5:138951257-138951279 CCTGCAGCCCCCCGAGCTTCAGG + Exonic
1002880833 6:1251019-1251041 TGCTCAGCCCACCGTGCTCCAGG + Intergenic
1003345322 6:5261083-5261105 CGTGCATCCAGCCAAGCTCCTGG + Exonic
1004235901 6:13874011-13874033 CCTGCGGCCCGCGCTGCTCCGGG + Intergenic
1006497870 6:34437114-34437136 CCTGCAGCCCGCCATGCCCGAGG - Intergenic
1006626995 6:35404630-35404652 AGGGCAGCCCTCTGTGCTCCTGG - Intronic
1007406325 6:41638174-41638196 CGTGCAGCCCGCGGATCTCCGGG + Intronic
1008030413 6:46688194-46688216 CGTGCATCCCGATGTGATCCCGG + Exonic
1008230799 6:48983540-48983562 CCTGCAGCCCGCCATGCCTCAGG - Intergenic
1009615471 6:65999487-65999509 CCTGCAGCCCGCCATGCACAAGG - Intergenic
1017498987 6:155006102-155006124 CGTGTAGCCCCCCGGGGTCCTGG + Intronic
1019197119 6:170289457-170289479 CCTGCAGCCCGCCCAGCTTCAGG + Intronic
1019791147 7:3014706-3014728 TGTGCAGCCCGCGGGTCTCCAGG - Intronic
1020106462 7:5424350-5424372 GGTGCAGCCAGCCGGGCCCCAGG - Intronic
1020188502 7:5976390-5976412 TGTGGGGCCCGCCCTGCTCCAGG - Intronic
1020294413 7:6748380-6748402 TGTGGGGCCCGCCCTGCTCCAGG + Intergenic
1022649604 7:32262459-32262481 CGTGCAGCCTGCCGTGTAGCAGG + Intronic
1023831132 7:44039576-44039598 GCTGCAGCCCACCGTGCGCCAGG - Intergenic
1023966617 7:44966186-44966208 CCTGCAGCCCGTGCTGCTCCAGG + Exonic
1029065317 7:97842971-97842993 CCTGCAGCCCGCCATGCCCGAGG - Intergenic
1029741460 7:102493882-102493904 GCTGCAGCCCACCGTGCACCAGG - Exonic
1029759452 7:102593051-102593073 GCTGCAGCCCACCGTGCGCCAGG - Exonic
1029776819 7:102688961-102688983 GCTGCAGCCCACCGTGCGCCAGG - Intergenic
1033013117 7:137643635-137643657 CGTGCAGCGAGCTGTGCTCATGG + Intronic
1034499386 7:151440097-151440119 AGTGCAGCCCGCCCTGCCCGGGG + Intronic
1036221172 8:6922772-6922794 CTTGCAGGCCGCTGTGCTCTGGG + Intergenic
1036614456 8:10377895-10377917 AGTGCAGGCCCCCGTGATCCAGG + Intronic
1037803892 8:22049091-22049113 CGTGCATCCAGCCGGGCCCCGGG + Intronic
1040501388 8:48008373-48008395 CGTGCAGGGCGGCGCGCTCCCGG + Intergenic
1049368899 8:142254130-142254152 CTTCCAGCCGGCCGGGCTCCCGG - Intronic
1049487863 8:142875806-142875828 CGTGCAGCAGGCCCTGCGCCAGG - Exonic
1049622693 8:143605762-143605784 CTCGCAGCCCGCCCTGCTCCAGG + Exonic
1049707479 8:144049583-144049605 ACTGCAGCCAGCCGTGGTCCAGG + Intergenic
1049773026 8:144392470-144392492 CATGCAGCGCCCCGTGCGCCTGG + Exonic
1049826228 8:144670581-144670603 CCTGCCTCCCGCCCTGCTCCAGG + Intergenic
1049847050 8:144807912-144807934 CGTGCAGCCGGTGGTGCTTCAGG - Exonic
1055574406 9:77647564-77647586 CCTGCACCCCGCTGGGCTCCAGG + Intronic
1060916949 9:127397478-127397500 CCTGCAGCGCGCCGCGCCCCCGG + Exonic
1061609923 9:131739659-131739681 TGTGCGGCCCTCCGTGCGCCGGG - Intronic
1061964446 9:134005108-134005130 AGTGCTGCCAGCCGTGCCCCAGG + Intergenic
1062535446 9:137019201-137019223 GCTGCAGCCTGCCCTGCTCCAGG + Exonic
1062567474 9:137169742-137169764 CTCGCTGCCCGCCGTGCCCCCGG - Exonic
1062584284 9:137241921-137241943 CGTGCCCCGCGCCGTGCTCGTGG + Exonic
1203364122 Un_KI270442v1:242927-242949 CCAGCAGGCCGCCGTGCTGCGGG - Intergenic
1185508309 X:644642-644664 CGCGCAGCCCCCCGCGCGCCCGG + Exonic
1189908834 X:45789213-45789235 CGTGCTGCCCGCCCTGCTCCTGG + Intergenic
1192231077 X:69265451-69265473 CCTGCAGCCCCCAGTGCTCTGGG - Intergenic
1196762014 X:119208824-119208846 CGTGCAGCCCCACGTCCTGCTGG + Intergenic
1198242114 X:134796919-134796941 GGTCCAGCCCCCCATGCTCCCGG + Intronic
1198363449 X:135917706-135917728 CCTACAGCCTGCCCTGCTCCCGG - Intergenic