ID: 943783295

View in Genome Browser
Species Human (GRCh38)
Location 2:191848118-191848140
Sequence GTCTCAAAATTGTTCATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943783295_943783300 18 Left 943783295 2:191848118-191848140 CCTTCTATGAACAATTTTGAGAC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 943783300 2:191848159-191848181 ACCAGGTCAGGGATTGATAATGG 0: 1
1: 0
2: 2
3: 6
4: 118
943783295_943783298 7 Left 943783295 2:191848118-191848140 CCTTCTATGAACAATTTTGAGAC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 943783298 2:191848148-191848170 TGCCAGCTCATACCAGGTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 121
943783295_943783297 6 Left 943783295 2:191848118-191848140 CCTTCTATGAACAATTTTGAGAC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 943783297 2:191848147-191848169 ATGCCAGCTCATACCAGGTCAGG 0: 1
1: 0
2: 1
3: 9
4: 99
943783295_943783296 1 Left 943783295 2:191848118-191848140 CCTTCTATGAACAATTTTGAGAC 0: 1
1: 0
2: 0
3: 8
4: 148
Right 943783296 2:191848142-191848164 AACAAATGCCAGCTCATACCAGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943783295 Original CRISPR GTCTCAAAATTGTTCATAGA AGG (reversed) Intergenic
903742460 1:25566125-25566147 TTTTCAAAATTGTTAATAAAGGG - Intronic
904405112 1:30283476-30283498 GCCTCATAATTTTTCATTGATGG - Intergenic
907817070 1:57929336-57929358 GTTTCAAATATGTTCATAAATGG + Intronic
908536323 1:65081451-65081473 GTATCACAATTGATCATTGAGGG - Intergenic
909491730 1:76233948-76233970 GTCTAAAAAGTGTCCTTAGAGGG + Intronic
910467175 1:87512640-87512662 GTCTAAAAATAGTTCTTATAAGG + Intergenic
917754812 1:178088581-178088603 GTCTCAAACTTGCTTATACATGG - Intergenic
919828249 1:201519433-201519455 GTCTCAAAATATGTCAAAGAAGG + Intergenic
921396106 1:214671252-214671274 GTCTCAAAATTAGTCATTGTAGG - Intergenic
1064321818 10:14311930-14311952 GTCTTAAAATTTTTCTTATATGG + Intronic
1065453060 10:25878917-25878939 GTCTCAAAATCATTCTGAGAGGG + Intergenic
1069171012 10:65228867-65228889 GTTTTAAAATTTTTTATAGAAGG - Intergenic
1069193140 10:65515273-65515295 CTCCCAAAACTGTACATAGAAGG - Intergenic
1071739150 10:88337145-88337167 GGCTCAAAACAGTTCACAGATGG + Intronic
1076082289 10:127593302-127593324 GTATCAGAATTGATCATTGAAGG - Intergenic
1078726506 11:13936785-13936807 GTTTCAAAATTGACCATAGTTGG - Intergenic
1081036296 11:38150214-38150236 TTCTCAAAACTGTTCAAACAAGG + Intergenic
1095452010 12:42341309-42341331 GTATCAGAATTGATCATAAATGG - Intronic
1097795630 12:63858603-63858625 GTTTAAAAATTATTCATACAAGG - Intronic
1099123142 12:78718141-78718163 TTCTCAAAAATATTCACAGAAGG - Intergenic
1099273582 12:80546497-80546519 GTCAAAAAATTGTTCATCAATGG - Intronic
1099993433 12:89751897-89751919 GCCACAAAATGGATCATAGAAGG - Intergenic
1100645651 12:96527405-96527427 GTCTCAGAATTGTTTATGGCAGG + Exonic
1100895994 12:99183155-99183177 GTCTCTAAATTTTTCAGATATGG - Intronic
1106246164 13:27952689-27952711 GTGTTAACATTGTTAATAGAGGG + Intergenic
1108206005 13:48091339-48091361 GTTTCAAACTTGTTGATAGATGG + Intronic
1108534424 13:51359089-51359111 TTCTCAAGATTGTTTATAGGTGG - Intronic
1109013594 13:56980366-56980388 GGCTCAAACTTGCTCCTAGATGG - Intergenic
1109621615 13:64914974-64914996 ATCTTTAAAATGTTCATAGAAGG - Intergenic
1109926902 13:69154189-69154211 ATCTGAAAAGTGTACATAGATGG - Intergenic
1110042119 13:70775191-70775213 GTAACAAAATTGTTATTAGAGGG + Intergenic
1110695231 13:78480065-78480087 TTCTAAAAGTTGCTCATAGAAGG + Intergenic
1116722914 14:48523785-48523807 ATCACAAAATGCTTCATAGAAGG + Intergenic
1116793349 14:49363369-49363391 GTCTCAACATTTTTTAAAGAAGG + Intergenic
1123429994 15:20206503-20206525 GTGTCATAATTGTTCACAAAGGG - Intergenic
1129018431 15:72490631-72490653 GTTTCAAAAATGTTCATATTTGG + Intronic
1129164081 15:73765840-73765862 GCATCAAAATTCTTCTTAGATGG - Intergenic
1131069667 15:89458051-89458073 GCCTCATAAGTGTTCATAGATGG + Intergenic
1131140419 15:89972612-89972634 GTTACAGAATTGTTCAAAGAAGG + Intergenic
1134028884 16:10976098-10976120 TTTTAAAAATTTTTCATAGAGGG - Intronic
1135783877 16:25330432-25330454 GTCTCAAAAGTGTTTATTGATGG - Intergenic
1137532289 16:49286400-49286422 ATTTCAAAATTGTTCATAATTGG + Intergenic
1138804402 16:60077112-60077134 GTCTTAAAATTTTTGATAGCTGG - Intergenic
1139196019 16:64919399-64919421 GTCTTAAAAATGTTCATACAAGG + Intergenic
1139457227 16:67090784-67090806 GTATTAAAATTGCTCATAGTAGG - Intronic
1143738340 17:8931364-8931386 GTCTTATAATTGTTCATGGAGGG - Intronic
1145256678 17:21328133-21328155 ATTTCAATATTGTTCATAGTAGG - Intergenic
1145319933 17:21759815-21759837 ATTTCAATATTGTTCATAGTAGG + Intergenic
1149616100 17:58000738-58000760 GTCTCCAAAGAGTTCATATAAGG - Intronic
1150464510 17:65380645-65380667 GACTCAAAATTGCACATAGCTGG - Intergenic
1153846740 18:9056977-9056999 TTCTGAAAATAATTCATAGATGG - Intergenic
1156853701 18:41757208-41757230 CTCTCAGAAATGTCCATAGAGGG + Intergenic
1157347068 18:46848280-46848302 GTCTGAAAACTTTTCATTGATGG - Intronic
1157581673 18:48777375-48777397 GTCTGAAAATTGCACATAGGAGG - Intronic
1159086047 18:63792930-63792952 GACTTAAAATTGTTAACAGAAGG - Intronic
1163393245 19:17043548-17043570 GTCTCAAAATTAATCAAAAATGG + Intergenic
1167773535 19:51538886-51538908 GTTTAAAAATTGTTCAAATAAGG - Intergenic
926012648 2:9421398-9421420 GCCTCAAAATTATTCATGGGTGG + Intronic
926880457 2:17539288-17539310 GTCTCAAGTTTGTTCAAAGCTGG + Intronic
928285651 2:29987943-29987965 GTCTCAAAATTGTCCTTTAAAGG - Intergenic
930195827 2:48509072-48509094 TTCACAATATTGTTCAAAGAGGG - Intronic
931170617 2:59799852-59799874 GTCTCAAACTTCTTCATTAAAGG + Intergenic
931270285 2:60695525-60695547 TTCTCAAAAGTGTTGATAGCTGG - Intergenic
931660457 2:64556818-64556840 TTCTCAATAATGTTCATATATGG - Intronic
932461839 2:71887248-71887270 CTCTCAGACATGTTCATAGACGG - Intergenic
939743077 2:145934703-145934725 CTCTCAAAATAGCTCATAAAAGG + Intergenic
940423069 2:153501195-153501217 GACTCAAAAATTTTCAAAGAAGG + Intergenic
940783987 2:157962394-157962416 GTCCCAGAAATGCTCATAGAAGG - Intronic
942229617 2:173848112-173848134 GTAGCAAAATAGTACATAGAGGG + Intergenic
943783295 2:191848118-191848140 GTCTCAAAATTGTTCATAGAAGG - Intergenic
945211403 2:207386880-207386902 CTCTCAAAATTGTGCCTAGGAGG - Intergenic
945615857 2:212065591-212065613 ATTTCAAATTTGTTCTTAGAAGG + Intronic
947135433 2:226972637-226972659 GACTCAAAAAATTTCATAGATGG - Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
948095080 2:235327086-235327108 ATTTCATAAATGTTCATAGACGG - Intergenic
1168821851 20:778915-778937 GTGTCAAAATTTGGCATAGAGGG + Intergenic
1169851837 20:10060816-10060838 GTCTCATAAGAGTTCATTGAGGG - Intergenic
1177520873 21:22223284-22223306 TTCTCAAAATTCTTCCCAGAAGG + Intergenic
1179832198 21:44004032-44004054 CTCTAAAAAGTGTTTATAGATGG + Intergenic
1181342709 22:22195615-22195637 GGCTGAAAAGTGGTCATAGAAGG - Intergenic
1184074479 22:42167449-42167471 GTCTCAGAAATATTCATTGAGGG - Intronic
949116198 3:327567-327589 CTCACAATATTGTTCATAAAAGG + Intronic
949622740 3:5833522-5833544 CTCAAAAAACTGTTCATAGAAGG - Intergenic
949750696 3:7349486-7349508 GTCTCAAAGATACTCATAGATGG + Intronic
954351871 3:50051343-50051365 GTCTCAAAATTTTTTTTAGCTGG + Intronic
955840260 3:63105245-63105267 GTCTCAAAATTGTGTTTAAAAGG - Intergenic
956010098 3:64821124-64821146 GTCTCAAAATTGTTCCATGTAGG + Intergenic
960614600 3:119585233-119585255 TTCACAAAAATGTTCATGGATGG - Intronic
960899303 3:122538592-122538614 GACTCAAAATTGTCAATAGCTGG + Intronic
961591479 3:127984840-127984862 GTCTCAAAATCGTGCATTAAGGG + Exonic
961982886 3:131100084-131100106 GGCTGAGAATTCTTCATAGATGG + Intronic
965090416 3:164155133-164155155 GTGTCAAAATTGTTGTTATAGGG + Intergenic
967085238 3:186088858-186088880 GTCTCAAAATTCGTCAAAAAAGG - Intronic
970732877 4:19127845-19127867 GTCTCAGAATTGATAATAGTTGG + Intergenic
972537790 4:40013642-40013664 GTCTCAAAATTTTTTTGAGACGG + Intergenic
974084503 4:57244875-57244897 GTATTTAAATTGTTCAAAGAGGG - Intergenic
974329636 4:60461444-60461466 GTTTCCGAATTGTTTATAGAGGG - Intergenic
977246079 4:94633159-94633181 GTTTCAAAATAGTTCAGAGATGG + Intronic
979896685 4:126166571-126166593 GTCTCAAAACTGCTAATAAAGGG + Intergenic
981827998 4:148966364-148966386 GTCTGAATATTATTTATAGATGG - Intergenic
986026585 5:3857234-3857256 GTATTAAAATAATTCATAGAGGG + Intergenic
990594000 5:57294902-57294924 ATCTCAAATTTGGTAATAGATGG + Intergenic
991047225 5:62235460-62235482 GTGTCATAATTGTTCACAAAGGG - Intergenic
991208184 5:64074176-64074198 GTCTCCAAATTGTACAGGGAAGG + Intergenic
994952574 5:106483228-106483250 GTGACAAAATTGTTCACAGAAGG + Intergenic
996910310 5:128649877-128649899 GTCTAAATATTGATAATAGAAGG - Intronic
998409325 5:141897202-141897224 GTACAAAAATTGTTCATATATGG - Intergenic
1000032119 5:157411436-157411458 GGCTCTAAGTTGGTCATAGATGG - Intronic
1000617379 5:163442944-163442966 GTCTCAAATTAGTTCATACTTGG - Intronic
1005677590 6:28171208-28171230 GTCTCAGAATTGTTTAGAGGAGG - Intergenic
1008441729 6:51539542-51539564 GTATAAAAATTGTTGATAGCTGG - Intergenic
1009906330 6:69873836-69873858 TTCTCAAACTTGTCCAAAGATGG - Intronic
1010496495 6:76539014-76539036 GCCTCAAAGTTGTCCTTAGAAGG + Intergenic
1010800856 6:80174224-80174246 GACTCATAATGGTTCATGGATGG + Intronic
1010931192 6:81805412-81805434 GTTTCAGAATTCTACATAGATGG - Intergenic
1011964131 6:93131926-93131948 GACTCAAACTTGGTCATTGATGG + Intergenic
1013805438 6:113991425-113991447 GTTTTATAATTGTTTATAGATGG - Intronic
1014087978 6:117370285-117370307 GTCCCCAAAGGGTTCATAGAAGG - Intronic
1014738270 6:125120444-125120466 GTCTCAAACTTGGCCCTAGATGG - Intronic
1015392604 6:132700073-132700095 GTTTCAAATTTGTTCACATATGG - Intronic
1015479120 6:133688781-133688803 GTCTCAGAATTGTCCAAACAGGG + Intergenic
1015653826 6:135494947-135494969 GTGTCAAAGCTGTTTATAGAGGG + Intronic
1015823413 6:137286750-137286772 GGCTCAAAGGTGTCCATAGAAGG + Intergenic
1016854910 6:148657692-148657714 GTATCAAAATTGCTAAAAGAAGG + Intergenic
1017918185 6:158849006-158849028 GTCTTAATACTGTTAATAGAGGG - Intergenic
1020210637 7:6155505-6155527 GACTCCCAATTGTTCATTGATGG - Intronic
1021784307 7:24136881-24136903 GTGTCAAAATTCATCACAGATGG - Intergenic
1023626198 7:42117426-42117448 TTCTCAAAACTGTTCCTAAAAGG - Intronic
1028361756 7:89976066-89976088 TTTTCAAAATTGTTCATGAAGGG - Intergenic
1030247963 7:107406210-107406232 GTCTCAGCATGGTTCATAGGAGG - Intronic
1030925887 7:115454020-115454042 GTCTCACTATTCTTCCTAGATGG + Intergenic
1033034509 7:137861306-137861328 GTCTCAAAATGGCTCATATTTGG - Intergenic
1034226186 7:149485303-149485325 CTCTCCAAAATGTTAATAGATGG + Intronic
1043301363 8:78738039-78738061 GTATCAAAATTATTTAAAGAAGG + Intronic
1043330598 8:79113369-79113391 TTTTCAAAATTATTAATAGATGG + Intergenic
1044186484 8:89258740-89258762 GTCTCACTATTACTCATAGATGG - Intergenic
1044473196 8:92596386-92596408 GTCTCAAAATCATTTCTAGATGG + Intergenic
1049119693 8:140723711-140723733 GTCTCAAACTTGCAAATAGATGG + Intronic
1049543450 8:143218796-143218818 GTCTCAAGAGTGAACATAGAGGG + Intergenic
1052378947 9:27748953-27748975 GTGTGACAAATGTTCATAGAGGG - Intergenic
1055261414 9:74438553-74438575 GTCCGAAAATTGTTCTTAGAAGG - Intergenic
1060053719 9:120395005-120395027 GTCTCAGCATTGTTCATGGTAGG + Intronic
1203397653 Un_KI270519v1:41302-41324 GTTTCAAAACTGCTCAAAGAAGG + Intergenic
1185684884 X:1920255-1920277 ATTTCAAAATTGTTCAGAGTAGG + Intergenic
1186236575 X:7517365-7517387 GTCTCAATATGTTTCTTAGATGG - Intergenic
1186752758 X:12638661-12638683 ATTTCAATAATGTTCATAGAAGG - Intronic
1187381176 X:18803457-18803479 GTCTCAAAATTGTTGGGAGCAGG - Intronic
1187560443 X:20397880-20397902 GTCTCAGAATAGTCCATGGAAGG - Intergenic
1188334932 X:28919668-28919690 GTCTAACCATTTTTCATAGATGG - Intronic
1189485363 X:41426558-41426580 GTTTCAAAATTGTCCAAAAATGG - Intergenic
1190580117 X:51884548-51884570 TTCTAACAATTGTTCAAAGAAGG + Intronic
1191130512 X:57003426-57003448 GTGAAAAAATTGTTCATACAAGG + Intergenic
1193932414 X:87570484-87570506 GTCTAAAAATTGTTCATGTTTGG - Intronic
1194439638 X:93916064-93916086 ATCTCAAAGATCTTCATAGAGGG + Intergenic
1195555724 X:106220458-106220480 TTGTCAAAATTTTTCATATATGG - Intergenic
1196472508 X:116044405-116044427 GCTTCAAAATTCTTCCTAGAAGG - Intergenic
1200778924 Y:7196953-7196975 GTCTTACAAAAGTTCATAGATGG - Intergenic