ID: 943785287

View in Genome Browser
Species Human (GRCh38)
Location 2:191870987-191871009
Sequence CTGAAAACAGAGATGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943785280_943785287 26 Left 943785280 2:191870938-191870960 CCAGTGGCTCCCCAAGTGGAGGC No data
Right 943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG No data
943785278_943785287 27 Left 943785278 2:191870937-191870959 CCCAGTGGCTCCCCAAGTGGAGG No data
Right 943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG No data
943785283_943785287 15 Left 943785283 2:191870949-191870971 CCAAGTGGAGGCTGTGTGCTGCA No data
Right 943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG No data
943785281_943785287 17 Left 943785281 2:191870947-191870969 CCCCAAGTGGAGGCTGTGTGCTG No data
Right 943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG No data
943785282_943785287 16 Left 943785282 2:191870948-191870970 CCCAAGTGGAGGCTGTGTGCTGC No data
Right 943785287 2:191870987-191871009 CTGAAAACAGAGATGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943785287 Original CRISPR CTGAAAACAGAGATGGAACT GGG Intergenic
No off target data available for this crispr