ID: 943786338

View in Genome Browser
Species Human (GRCh38)
Location 2:191882046-191882068
Sequence GGAGATCGCCGAGGCCTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943786338_943786347 19 Left 943786338 2:191882046-191882068 CCTCATAGGCCTCGGCGATCTCC 0: 1
1: 0
2: 0
3: 10
4: 98
Right 943786347 2:191882088-191882110 CGGGCTCCTTGTTCTTGTCTGGG 0: 1
1: 1
2: 0
3: 4
4: 75
943786338_943786348 22 Left 943786338 2:191882046-191882068 CCTCATAGGCCTCGGCGATCTCC 0: 1
1: 0
2: 0
3: 10
4: 98
Right 943786348 2:191882091-191882113 GCTCCTTGTTCTTGTCTGGGTGG 0: 1
1: 1
2: 1
3: 23
4: 197
943786338_943786346 18 Left 943786338 2:191882046-191882068 CCTCATAGGCCTCGGCGATCTCC 0: 1
1: 0
2: 0
3: 10
4: 98
Right 943786346 2:191882087-191882109 CCGGGCTCCTTGTTCTTGTCTGG No data
943786338_943786340 -7 Left 943786338 2:191882046-191882068 CCTCATAGGCCTCGGCGATCTCC 0: 1
1: 0
2: 0
3: 10
4: 98
Right 943786340 2:191882062-191882084 GATCTCCTTGAACTTCTCCTCGG 0: 2
1: 0
2: 2
3: 21
4: 217
943786338_943786343 0 Left 943786338 2:191882046-191882068 CCTCATAGGCCTCGGCGATCTCC 0: 1
1: 0
2: 0
3: 10
4: 98
Right 943786343 2:191882069-191882091 TTGAACTTCTCCTCGGCGCCGGG No data
943786338_943786342 -1 Left 943786338 2:191882046-191882068 CCTCATAGGCCTCGGCGATCTCC 0: 1
1: 0
2: 0
3: 10
4: 98
Right 943786342 2:191882068-191882090 CTTGAACTTCTCCTCGGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943786338 Original CRISPR GGAGATCGCCGAGGCCTATG AGG (reversed) Intergenic
903539602 1:24089600-24089622 CGAGATCCGAGAGGCCTATGTGG - Exonic
906944756 1:50286265-50286287 AGAGATGGCAGAGGCCTTTGAGG - Intergenic
915678205 1:157551810-157551832 GGAGGTCGCAGAGGCGTAGGTGG - Intronic
917845101 1:179014186-179014208 GCAGATGGCAGAGGCCTTTGAGG + Intergenic
1063964425 10:11335624-11335646 GGAGACTGCCGAAGGCTATGAGG - Exonic
1066791033 10:39063913-39063935 GGAGCCCACAGAGGCCTATGGGG - Intergenic
1066793630 10:39094250-39094272 GGAGCCCACTGAGGCCTATGAGG + Intergenic
1066794671 10:39106380-39106402 GGAGCCCATCGAGGCCTATGTGG + Intergenic
1066796189 10:39124035-39124057 GGAGTTCCTTGAGGCCTATGGGG + Intergenic
1066807435 10:39274190-39274212 GGAGCTCACTGAGGCCTATGGGG - Intergenic
1072834135 10:98693092-98693114 GGCCATTGCCAAGGCCTATGAGG + Intronic
1082811955 11:57483636-57483658 GGAGATGGCCAAGGCCTCTGAGG + Intergenic
1085472097 11:76764967-76764989 GGGGCTGGCCGAGGCCTTTGTGG - Intergenic
1085812259 11:79694705-79694727 GGAGAAAGCCAAGGCCTATCTGG + Intergenic
1090935979 11:131342639-131342661 GGAGGTCCCAGAGGCCAATGAGG - Intergenic
1094857504 12:34416737-34416759 GGAGCTCACTGAGGCCTTTGGGG - Intergenic
1095056580 12:37612264-37612286 GGAGATCTTTGAGGCCTATGTGG + Intergenic
1095081191 12:38001558-38001580 GGAGTCCACTGAGGCCTATGGGG + Intergenic
1098058462 12:66534580-66534602 GGAGATAGATGAGGCCAATGAGG - Intronic
1098557947 12:71840019-71840041 GAAGAGCGCCGAGGCCTAGCTGG - Intronic
1100396281 12:94188864-94188886 GGAGGTGGCAGAGGCCTGTGTGG + Intronic
1105094948 13:16353941-16353963 GGAGCGCTCTGAGGCCTATGGGG + Intergenic
1105122191 13:16799260-16799282 GGAGCGCCCTGAGGCCTATGGGG + Intergenic
1105136859 13:17038865-17038887 GGAGCGCCCTGAGGCCTATGGGG + Intergenic
1112998197 13:105599823-105599845 GGAGATCACGGAAGCCCATGAGG - Intergenic
1114000810 14:18242166-18242188 GGAGAGCTTTGAGGCCTATGGGG - Intergenic
1114001723 14:18259399-18259421 GGAGAGCTTTGAGGCCTATGTGG - Intergenic
1117812973 14:59568094-59568116 GGAGATGGCCCAGGCTGATGGGG - Intronic
1118292794 14:64541236-64541258 GGAGATCGCGGAAGCCTACCTGG + Exonic
1125663246 15:41410911-41410933 GGAGATCGCTGGGGCCTGGGAGG + Intronic
1128144516 15:65325360-65325382 AGAGAGCGCTGAGGCCTATAGGG - Intergenic
1129333371 15:74838939-74838961 GGAGATCTCGGGGGCCTCTGGGG - Intronic
1136740708 16:32521797-32521819 GGAGATCATTGAGGCCAATGGGG - Intergenic
1136745088 16:32579666-32579688 GGAGCCCACTGAGGCCTATGGGG + Intergenic
1137802658 16:51275488-51275510 GGAGATGGCCTAAGCCCATGGGG + Intergenic
1137949843 16:52773342-52773364 GGAGTTCCCTGAGGCCTATGGGG + Intergenic
1141161233 16:81630479-81630501 AGTGACCGCCCAGGCCTATGGGG + Intronic
1141171183 16:81692718-81692740 CAAGAGCGCCCAGGCCTATGGGG - Intronic
1203028894 16_KI270728v1_random:553436-553458 GGAGATCATTGAGGCCAATGGGG + Intergenic
1203042827 16_KI270728v1_random:780995-781017 GGAGATCATTGAGGCCAATGGGG - Intergenic
1203047213 16_KI270728v1_random:838875-838897 GGAGCCCACTGAGGCCTATGGGG + Intergenic
1144490493 17:15704465-15704487 GGAGAACTCCGAGGAGTATGCGG - Intronic
1146630919 17:34468766-34468788 GGAGATTGCTGTGGCCTAAGAGG - Intergenic
1147731887 17:42609306-42609328 GGAGATGGCTGAGGCCGAAGGGG - Exonic
1152368694 17:79871710-79871732 GGGGATCACCGAGGCCGGTGGGG - Intergenic
1155201111 18:23518402-23518424 GAAGATCGCCAAAGCCTAGGAGG + Intronic
1161069073 19:2251516-2251538 GGGGATCGCCGAGGCCGCCGGGG - Exonic
1163284100 19:16335527-16335549 TGAGATGGCCGGGGCCTAGGTGG - Intergenic
1166299819 19:41907252-41907274 AGAGATGGCCGAGGCTCATGCGG - Exonic
1168326414 19:55540944-55540966 GGGGAGCGCCGTGTCCTATGAGG - Exonic
931317513 2:61146631-61146653 GGAGACCGTCGTGGCCAATGTGG + Intronic
935589726 2:104835397-104835419 TGAGACCGCTGAGGCCTGTGGGG - Intergenic
943786338 2:191882046-191882068 GGAGATCGCCGAGGCCTATGAGG - Intergenic
947903662 2:233743754-233743776 GCAGGTGGCCGAGGCCTACGAGG - Intronic
949008759 2:241666805-241666827 GGACATCAACGAGGCCTACGTGG + Exonic
1170568775 20:17621385-17621407 GGAGAGCTTCGGGGCCTATGGGG - Intronic
1171578095 20:26359936-26359958 GGAGAACTTTGAGGCCTATGGGG + Intergenic
1172596425 20:36154172-36154194 GGAGGACGCCGAGTCCTAGGCGG + Intronic
1175741391 20:61421976-61421998 GGTGATAGCCGCGGCCTGTGAGG - Intronic
1180425321 22:15172964-15172986 GGAGAGCTTTGAGGCCTATGGGG - Intergenic
1180426230 22:15190194-15190216 GGAGAGCTTTGAGGCCTATGTGG - Intergenic
1183296016 22:37029997-37030019 GGAGAACGCCCAGGATTATGGGG - Intergenic
950005056 3:9686211-9686233 GGAGTTCACGGAGGCCTCTGAGG - Intronic
954485724 3:50849542-50849564 GGAGATCACTAAGGCCTAGGAGG - Intronic
958870404 3:99551845-99551867 GGAGATCCAAGAGGCCAATGAGG + Intergenic
961774192 3:129272300-129272322 GGAGCCCACTGAGGCCTATGAGG + Exonic
967074451 3:185989615-185989637 GCAGATGGCAGAGGCCTGTGAGG + Intergenic
969630048 4:8330654-8330676 GGAGACCCCAGAGGCCTTTGGGG + Intergenic
972092415 4:35304045-35304067 GGAGATGGCTGAGGTCTCTGAGG + Intergenic
1005992923 6:30914472-30914494 GGAGATCGCCGCGGCCCTGGCGG + Intronic
1006110351 6:31740601-31740623 GGAGCTGGCCGAGGTCTCTGAGG + Exonic
1006122560 6:31816140-31816162 GGAGATCGCCGAGGCGTACCTGG + Exonic
1006124423 6:31828334-31828356 GGAGATCGCCGAGGCGTACCTGG + Exonic
1007497400 6:42269429-42269451 GGAGATTGGCGAGGCCTGAGGGG + Exonic
1025523306 7:61769875-61769897 GGAGCTCATTGAGGCCTATGGGG - Intergenic
1025534127 7:61927105-61927127 GGAGATCATTGAGGCCTATGGGG + Intergenic
1025535834 7:61946968-61946990 GGAGTTCATTGAGGCCTATGGGG + Intergenic
1025536560 7:61955631-61955653 GGAGTGCACTGAGGCCTATGGGG + Intergenic
1025547061 7:62188903-62188925 GGAGCTCATTGAGGCCTATGGGG - Intergenic
1025597201 7:62945218-62945240 GGAGATCATTGAGGCCAATGGGG + Intergenic
1029365198 7:100112131-100112153 GGAGATCACCGAGGCCTGCGTGG - Exonic
1034192230 7:149221597-149221619 GGAGATCGCTGTGGCCTCTGTGG - Intronic
1038326525 8:26576990-26577012 GCAGCCCGCCGAGGCCGATGTGG - Intronic
1040126461 8:43743107-43743129 GGAGATCATTGAGGACTATGGGG + Intergenic
1040126713 8:43746000-43746022 GGAGCCCACCGAGACCTATGGGG + Intergenic
1040129921 8:43783473-43783495 GGAGCCCTCTGAGGCCTATGAGG + Intergenic
1040130275 8:43787618-43787640 GGAGACCATTGAGGCCTATGAGG + Intergenic
1040130969 8:43796105-43796127 GGAGACCATTGAGGCCTATGGGG + Intergenic
1040132377 8:43812288-43812310 GGAGCTCATTGAGGCCTATGGGG + Intergenic
1040134231 8:43833910-43833932 GGAGCTCACTGAGGACTATGGGG + Intergenic
1040135704 8:43851206-43851228 GGAGACCATTGAGGCCTATGTGG + Intergenic
1040136420 8:43859575-43859597 GGAGAGCTTTGAGGCCTATGGGG + Intergenic
1040137442 8:43871197-43871219 GGAGCCCACTGAGGCCTATGGGG + Intergenic
1040138941 8:43887822-43887844 AGAGCTCACTGAGGCCTATGGGG + Intergenic
1048356117 8:133655195-133655217 GGGTATCTCCCAGGCCTATGGGG - Intergenic
1048469707 8:134695763-134695785 AGAGATGGCCGAGGCCTAGGGGG - Intronic
1053938298 9:43194681-43194703 GGAGAGCTTTGAGGCCTATGTGG + Intergenic
1053938333 9:43195343-43195365 GGAGAGCTTTGAGGCCTATGTGG + Intergenic
1060505858 9:124198019-124198041 GGAGATCCCTGAGGCATCTGGGG - Intergenic
1060531193 9:124347859-124347881 GGAGGCCACCGAGGCTTATGAGG + Intronic
1062117982 9:134819266-134819288 GGAGATCCCGGAGGCCCCTGCGG + Intronic
1062133397 9:134912413-134912435 GCAGATGGCCCAGGCCTAAGGGG + Intronic
1062620539 9:137419077-137419099 GGAGATGTACGAGGCTTATGTGG + Intronic
1188784363 X:34326330-34326352 GGAGATAGACGAGCACTATGTGG + Intergenic
1191577305 X:62720395-62720417 GGAGCCCACTGAGGCCTATGGGG - Intergenic
1191578223 X:62730819-62730841 GGAGTCCACTGAGGCCTATGGGG - Intergenic
1200072564 X:153536388-153536410 GAAGATCGAGGAGGCCTACGGGG + Exonic
1201779629 Y:17705176-17705198 GGAGCTCATTGAGGCCTATGGGG - Intergenic
1201821926 Y:18200816-18200838 GGAGCTCATTGAGGCCTATGGGG + Intergenic