ID: 943786339

View in Genome Browser
Species Human (GRCh38)
Location 2:191882055-191882077
Sequence GAAGTTCAAGGAGATCGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943786339_943786347 10 Left 943786339 2:191882055-191882077 CCTCGGCGATCTCCTTGAACTTC 0: 1
1: 1
2: 0
3: 17
4: 106
Right 943786347 2:191882088-191882110 CGGGCTCCTTGTTCTTGTCTGGG 0: 1
1: 1
2: 0
3: 4
4: 75
943786339_943786348 13 Left 943786339 2:191882055-191882077 CCTCGGCGATCTCCTTGAACTTC 0: 1
1: 1
2: 0
3: 17
4: 106
Right 943786348 2:191882091-191882113 GCTCCTTGTTCTTGTCTGGGTGG 0: 1
1: 1
2: 1
3: 23
4: 197
943786339_943786343 -9 Left 943786339 2:191882055-191882077 CCTCGGCGATCTCCTTGAACTTC 0: 1
1: 1
2: 0
3: 17
4: 106
Right 943786343 2:191882069-191882091 TTGAACTTCTCCTCGGCGCCGGG No data
943786339_943786342 -10 Left 943786339 2:191882055-191882077 CCTCGGCGATCTCCTTGAACTTC 0: 1
1: 1
2: 0
3: 17
4: 106
Right 943786342 2:191882068-191882090 CTTGAACTTCTCCTCGGCGCCGG No data
943786339_943786350 28 Left 943786339 2:191882055-191882077 CCTCGGCGATCTCCTTGAACTTC 0: 1
1: 1
2: 0
3: 17
4: 106
Right 943786350 2:191882106-191882128 CTGGGTGGTAGCGCAGCGCCTGG 0: 1
1: 1
2: 0
3: 13
4: 140
943786339_943786346 9 Left 943786339 2:191882055-191882077 CCTCGGCGATCTCCTTGAACTTC 0: 1
1: 1
2: 0
3: 17
4: 106
Right 943786346 2:191882087-191882109 CCGGGCTCCTTGTTCTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943786339 Original CRISPR GAAGTTCAAGGAGATCGCCG AGG (reversed) Intergenic
902204066 1:14854448-14854470 GAAGTTCAAGGACATGACCCTGG + Intronic
903546174 1:24124668-24124690 GGAGTTCACAGTGATCGCCGAGG - Intronic
908360049 1:63359970-63359992 GAAGTTCAAGGAAATTGGAGAGG - Intergenic
911210315 1:95132090-95132112 GAAGTTCAAGGGCATGGCCCTGG - Intronic
912430346 1:109625412-109625434 CAAATGCAAGGAGATCGCCGAGG + Exonic
912664956 1:111570638-111570660 GAAGTTCAAGGGCATGGCCCTGG + Intronic
912752517 1:112297533-112297555 GAAGTTCAAGGGCATGGCCTTGG + Intergenic
920978308 1:210807219-210807241 GAAGCACAAGGAGATCTCTGTGG - Intronic
922494432 1:226044917-226044939 GAAGTTCAAGGGCATGGCCCTGG - Intergenic
923412019 1:233720019-233720041 GAACTTCAAGGAGATTGTGGTGG - Intergenic
1065692315 10:28347237-28347259 GAAGTTCAAGGGCATGGCCTTGG + Intergenic
1066377372 10:34869576-34869598 GAAGTTCAAGGGCATGGCCGTGG + Intergenic
1067535119 10:47103338-47103360 AAAGTTCTAGGACATCTCCGTGG - Intergenic
1067551999 10:47242794-47242816 GAAGTTCAGGGTGAACTCCGGGG + Intergenic
1070806017 10:79271161-79271183 GAAGTTCATGGAGATGGTGGGGG - Intronic
1074735721 10:116430558-116430580 GAAGTTCAAGGAGAGTACAGGGG + Intronic
1080099779 11:28446243-28446265 GAAGTCCAAGCAGATGGCCTTGG - Intergenic
1080402012 11:31945053-31945075 GAAGTTCAAGTAGAGAGCCTAGG - Intronic
1084725965 11:70942245-70942267 GAAGTTCAAGGGCATCGCCTTGG + Intronic
1085328231 11:75625058-75625080 GGAGTTCAAGGGCCTCGCCGAGG + Intronic
1085681322 11:78577721-78577743 GAAGTTCAAGGGCATGGCCCTGG - Intergenic
1091530545 12:1350791-1350813 GAAGTTCAAGGGCATGGCCCTGG + Intronic
1093478511 12:19581193-19581215 GAAGTTCAAGGGTATGGCCTTGG - Intronic
1114950354 14:27743093-27743115 GAAGTTCAAGGCCATGGCCCTGG - Intergenic
1115764811 14:36612849-36612871 GAAGTTCAAGGATATGGCCCTGG + Intergenic
1118239938 14:64046560-64046582 GAAGTTCAAGGAGTTCACCATGG - Intronic
1119126481 14:72131949-72131971 GTAGTTCATGAAGATCGCCTAGG - Intronic
1121546545 14:94767737-94767759 GAAGTTCCAGGAAAGCGCTGGGG + Intergenic
1122950960 14:105044555-105044577 GAAGTTCAAGGGCATGGCCCTGG - Intergenic
1128646489 15:69382309-69382331 GAAGTTCAAGGAGGTGGGAGGGG + Intronic
1128930027 15:71696204-71696226 GAAGTTCAAGAGCATGGCCGTGG + Intronic
1130677156 15:85963155-85963177 GAAGTTCAAGGGCATGGCCCTGG + Intergenic
1135409938 16:22225950-22225972 GAAGTGGAAGGAGTTTGCCGGGG - Exonic
1136372894 16:29847310-29847332 GAAGTTCAAGCAGATGACAGAGG + Exonic
1138793575 16:59939681-59939703 GAACTTCAAGGAGATAGACTGGG - Intergenic
1139157560 16:64462355-64462377 GAAGTTCAAAGACATAGCCCTGG + Intergenic
1139689075 16:68628088-68628110 GAAATTCAAGGACATGGCCCTGG + Intergenic
1143208382 17:5163303-5163325 GAAGTTCAAGGACATGGTCCTGG + Intronic
1143828444 17:9631653-9631675 GAAGTTAAAAGAGATGGCGGGGG + Intronic
1149871889 17:60190243-60190265 GAAGTTCAAGGACATGGTCCTGG - Intronic
1150622634 17:66819637-66819659 GAAGTTCAAGGCCATGGCCCTGG - Intergenic
1152832341 17:82505499-82505521 GAAGTTCAAGGGCATGGCCCTGG + Intergenic
1156170773 18:34482398-34482420 GAAGTTCAAGGACATGGCACTGG - Intergenic
1157455550 18:47825538-47825560 GAAGTTCAAGGGCATGGCCCTGG - Exonic
1157751644 18:50183994-50184016 GAAGTTCAAGGGCATTGCCCTGG - Intronic
1159790663 18:72776097-72776119 GAAGTTCAAGGGCATGGCCCTGG + Intronic
1163011956 19:14432184-14432206 GAATTTCTAGGGGATCTCCGGGG - Intergenic
1163026972 19:14518199-14518221 GAAGTTCAAGGAGATCGCTGAGG - Exonic
1163677397 19:18662226-18662248 GAAGTTCAAGGAGATTTGCGGGG - Intronic
1166009095 19:39927878-39927900 GAATGTCAAGGAGTTTGCCGTGG - Exonic
1167515561 19:49921415-49921437 GAAGGTCATGGAGATGGCCCAGG - Intronic
1167643050 19:50692652-50692674 GAAGTTCAAGGAGACTGTGGTGG - Intronic
926461582 2:13136122-13136144 GAAGTTCAAGGGGATTGTCCTGG - Intergenic
934089783 2:88541126-88541148 GAAGTTCAAGGACATGGCTCTGG + Intergenic
937341030 2:121090639-121090661 GAAGGACCAGGAGATCGCAGTGG + Intergenic
939266854 2:139885310-139885332 GAAGTTCAAGGACATGGCCCTGG + Intergenic
941946199 2:171100532-171100554 GAGGTTCAAGGACATGGCCTTGG - Intronic
943274803 2:185852972-185852994 GAAGTTCAAAGACATGGCCCTGG + Intergenic
943786339 2:191882055-191882077 GAAGTTCAAGGAGATCGCCGAGG - Intergenic
945760519 2:213908495-213908517 GAAGTTCAGTGAGATCACAGAGG - Intronic
946370903 2:219280644-219280666 GAAATTTAAGGAGGTGGCCGAGG + Exonic
1171348547 20:24485116-24485138 GAAGTTCAAGGCCATGGCCCCGG - Intronic
1172960857 20:38798457-38798479 GAAGTTCAAGGGCATGGCCCAGG - Intergenic
1173829343 20:46070455-46070477 GAAGTCCAAGGAGAGAGCCCAGG - Exonic
1174200235 20:48802002-48802024 GAAGTTCAAGGGCATGGCCATGG - Intronic
1176895916 21:14378298-14378320 GAAGTTAAAGGAAATGGCAGAGG - Exonic
1184892903 22:47390309-47390331 GAGGTTCAAGGACACCGCTGAGG + Intergenic
949981780 3:9506498-9506520 GAAGTTGAAGGAGGTGGCTGTGG - Intronic
951433179 3:22631839-22631861 GAAGTTCAAGGGCATGGCTGTGG + Intergenic
953273976 3:41476437-41476459 GAAGTTCAAGGATATTGCCAAGG + Intronic
954036840 3:47855304-47855326 GAACTTCAAGGAGAAGGCCCAGG - Exonic
961587271 3:127942816-127942838 GAAGTTCAAGGACATGACCTTGG + Intronic
977559383 4:98516932-98516954 GAAGTTCAAGGGCATGGCCCTGG - Intronic
981061598 4:140431077-140431099 GAAGTTCAAGGACATGGCTCTGG - Intergenic
981852053 4:149242474-149242496 GAAATTCAAGGAGATGGCCATGG + Intergenic
982676254 4:158379703-158379725 GAAGTTCAAGGGCATAGCCTCGG - Intronic
984613353 4:181866908-181866930 GAGGTTAGATGAGATCGCCGAGG - Intergenic
985494148 5:195155-195177 GAAATACGACGAGATCGCCGAGG + Exonic
986243896 5:5987792-5987814 GAAGTTCAAGGACATGACCTTGG + Intergenic
991188116 5:63834813-63834835 GAAGTTCAAGGGCATGGCCCTGG - Intergenic
991897681 5:71421752-71421774 GAAGTTCAAGGCCATAGCCCTGG - Intergenic
992770229 5:80040800-80040822 GAAGTTCAAGGGCATGGCCCTGG + Intronic
994708945 5:103242358-103242380 GAAGTTCAAGAACATGGCTGTGG - Intergenic
995149169 5:108822409-108822431 GAAGTTCAAGGTCATCACCCTGG + Intronic
995490725 5:112689001-112689023 GAACTTCAAGGAGCTCACTGAGG - Intergenic
1003206956 6:4021416-4021438 GAAGTTCAAGATGGCCGCCGCGG + Exonic
1004015279 6:11726556-11726578 GAAGTTCAAGGGCATGGCCCTGG - Intronic
1004684819 6:17933079-17933101 AAGGTTCAAGGATATGGCCGAGG - Intronic
1005563085 6:27061423-27061445 GAAGTTCAAGGGCATGGCCTTGG + Intergenic
1006122559 6:31816131-31816153 CAAGATGAAGGAGATCGCCGAGG + Exonic
1006124422 6:31828325-31828347 CAAGATGAAGGAGATCGCCGAGG + Exonic
1006254454 6:32819166-32819188 GAAGTTCAAGGTCATGGCCCTGG - Intronic
1009726623 6:67543393-67543415 GAAGTCAAAGGAGATCACCTTGG + Intergenic
1010265900 6:73866549-73866571 GAAGTTCAAGGGCATTGCCCTGG - Intergenic
1011450757 6:87489492-87489514 GAAGTTCAAGGGCATGGCCCTGG - Intronic
1011546710 6:88489504-88489526 GAAGTCCAGGGAGATCACCGTGG - Intergenic
1015942013 6:138462223-138462245 GAAGTTCAAGGGCATGGCCCTGG + Intronic
1017846196 6:158260633-158260655 GATGCTGAAGGAGATCGCCTAGG + Intronic
1018035198 6:159875689-159875711 GAAGTTCAAGGGCATGGCCCTGG - Intergenic
1029459747 7:100687847-100687869 GCAGGACAAGGAGTTCGCCGCGG - Exonic
1029687055 7:102156308-102156330 GAAGTTCAAGGACATGGCCCTGG + Intronic
1032547724 7:132757709-132757731 GAAGTTCAAGGGCATGGCCCTGG + Intergenic
1035038244 7:155909181-155909203 GAAGTTCAAGGGCATGGCCCAGG + Intergenic
1037772847 8:21812591-21812613 GAAGTTCAGAGAGATAGCTGAGG - Intergenic
1039491940 8:37954290-37954312 GAAGTTTAAGGGGATGGCCCTGG - Intergenic
1040029778 8:42813882-42813904 GAAGTTCAAGGGCATGGCCCTGG - Intergenic
1042249217 8:66739170-66739192 GAAGTTCAAGGACATGGCGCTGG + Intronic
1044268494 8:90211574-90211596 GAAGTTCAAGGGCATAGCCCTGG + Intergenic
1047715117 8:127588224-127588246 GAAGTTCAAGGAGGTTGCTTTGG + Intergenic
1047845129 8:128797496-128797518 AAAGTTCAAGGACATAGCCCTGG + Intergenic
1048208534 8:132435149-132435171 GAAGTTCAAGGAGCATGCCCAGG + Intronic
1048287999 8:133157343-133157365 GAAGTTGGATGAGATCGCCAAGG + Intergenic
1050328834 9:4524608-4524630 GAAGTTCAAGGGCATGGCCCTGG + Intronic
1053055982 9:34993362-34993384 GAAGTTTAAGGAGATTGCAGAGG + Exonic
1055997181 9:82172701-82172723 GAAGTTCAAGGGCATGGCCTTGG + Intergenic
1059266358 9:113035042-113035064 GAAGTTCCAGGACATGGCCCTGG - Intergenic
1060152189 9:121295811-121295833 AGAGGTCAAGGAGATCTCCGAGG + Intronic
1186707687 X:12159408-12159430 GAACTCCAAGGAGATCTCTGTGG - Intronic
1187598063 X:20796701-20796723 GAAGTTCAAGGTCATGGCCCTGG - Intergenic
1189329287 X:40133428-40133450 GAAATTGAAGTAGATGGCCGGGG - Intronic
1189928076 X:45978204-45978226 GAAGTTCAAGGACATGGCCTTGG + Intergenic
1192565557 X:72160627-72160649 GAAGTTCAAGGGCATGGCCCTGG + Intergenic
1196103527 X:111872091-111872113 GAAGTTCAAGGGCATGGCCCTGG - Intronic
1196223353 X:113137816-113137838 GAAGTTCAAGGACATGGCCCTGG + Intergenic
1199929374 X:152503149-152503171 GAAGTTCAAGGGGATGGCCCTGG + Intergenic